National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2005R-4 
 Symbol Ptp99A  Full Name Protein tyrosine phosphatase 99A 
 CG No CG11516  Old CG No CG2005 
 Synonyms DPTP99A, CT6383, R-PTP 99A, CG11516, CG2005, PTP99A, dptp99A, DPTP[[99A]], CG11515, CG11517, Ptp99A 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCCCACCAACTCCTCCAAC 
 Primer Seq. 3'
aatctagaggtaccTTCTTTGGCGGATGCCAGGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

2005R-4.IR full       1   CTGCCCACCAACTCCTCCAACTCGCCATCGTCGCCATCGCCCTTCACCGTCGCCTCATTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
2005R-4.in silico     1   CTGCCCACCAACTCCTCCAACTCGCCATCGTCGCCATCGCCCTTCACCGCCGCCTCATTG 60


2005R-4.IR full       61  CCGCCCACCACTGCATCATCGTCATCATCACCGGCGGTCATTAGTACCAGTTCTTTCGAT 120
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||
2005R-4.in silico     61  CCGCCCACCACTGCATCGTCGTCATCATCACCGGCGGTCATTAGTACCAGTTCTTCCGAT 120


2005R-4.IR full       121 CGCAATCTGGCCGATCTAGTCAATCCGGAGGCCGAAACATCCGGATCCGGCTGGGAATCA 180
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
2005R-4.in silico     121 CGCAATCTGGCCGATCTAGTCAATCCGGAGGCCGAAACAACCGGATCCGGCTGGGAATCA 180


2005R-4.IR full       181 CTTGAGACTGAATTCAATCTGGCCACCACTGTGGACAGCAGCACCCAGAAGACGGCAAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
2005R-4.in silico     181 CTTGAGACTGAATTCAATCTGGCCACCACTGTGGACAGCAGCACCCAGAAGACGGAAAAG 240


2005R-4.IR full       241 GAACCGGTGCTGGGCACCGNAGCCACCTCCATTGAGCAGCAGGATCAGCCGCCGGATGTG 300
                          || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
2005R-4.in silico     241 GAGCCGGTGCTGGGCACCGTAGCCACCTCCATTGAGCAGCAGGATCAGCCGCCGGATGTG 300


2005R-4.IR full       301 CCAGCCACCACGTTGGCCTTCGCCAATGCGTTTCCGGTTCCGGTGGCCGGAGAAATGGGA 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
2005R-4.in silico     301 CCAGCCACCACGTTGGCCTTCGCCAATGCGTTTCCGGTTCCGGTGGCCGGCGAAATGGGA 360


2005R-4.IR full       361 AACGGAAATGGCAACTATAACGATGCCACGCCCCCGTACGCAGCGGTCGACGACAATTAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2005R-4.in silico     361 AACGGAAATGGCAACTATAACGATGCCACGCCCCCGTACGCAGCGGTCGACGACAATTAT 420


2005R-4.IR full       421 GTGCCAAGCAAACCGCAGAATCTAACCATCTTGGATGTTTCGGCCAACAGCATCACGATG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2005R-4.in silico     421 GTGCCAAGCAAACCGCAGAATCTAACCATCTTGGATGTTTCGGCCAACAGCATCACGATG 480


2005R-4.IR full       481 TCCTGGCATCCGC------- 500
                          |||||||||||||       
2005R-4.in silico     481 TCCTGGCATCCGCCAAAGAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_206579.1  Protein tyrosine phosphatase 99A CG2005-RC, transcript variant C (Ptp99A), mRNA 
100  482  NM_170409.1  Protein tyrosine phosphatase 99A CG2005-RA, transcript variant A (Ptp99A), mRNA 
100  482  NM_057468.2  Protein tyrosine phosphatase 99A CG2005-RB, transcript variant B (Ptp99A), mRNA 
100  482  NM_001014683.1  Protein tyrosine phosphatase 99A CG2005-RD, transcript variant D (Ptp99A), mRNA 
12.86  62  NM_001043332.1  Protein tyrosine phosphatase 99A CG2005-RE, transcript variant E (Ptp99A), mRNA 
NM_165965.1  CG3884-RA, transcript variant A (CG3884), mRNA 
18  NM_140110.2  CG8108-RB, transcript variant B (CG8108), mRNA 
18  NM_168386.1  CG8108-RA, transcript variant A (CG8108), mRNA 
NM_078977.2  toutatis CG10897-RA, transcript variant A (tou), mRNA 
13  NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
13  NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
NM_132516.2  inaF CG2457-RA (inaF), mRNA 
NM_141323.1  CG2097-RA (CG2097), mRNA 
11  NM_001014525.1  CG33528-RD, transcript variant D (CG33528), mRNA 
10  NM_078582.3  Tenascin accessory CG32659-RA (Ten-a), mRNA 
NM_001014526.1  CG33528-RE, transcript variant E (CG33528), mRNA 
NM_001014524.1  CG33528-RC, transcript variant C (CG33528), mRNA 
NM_131954.1  CG7024-RA (CG7024), mRNA 
24  NM_132831.1  CG8184-RB (CG8184), mRNA 
11  NM_136882.2  jelly belly CG30040-RA (jeb), mRNA 
NM_164887.1  CG31714-RA (CG31714), mRNA 
NM_143513.1  CG7950-RA, transcript variant A (CG7950), mRNA 
NM_170464.1  CG7950-RB, transcript variant B (CG7950), mRNA 
NM_141433.2  CG1104-RA, transcript variant A (CG1104), mRNA 
NM_169165.1  CG1104-RB, transcript variant B (CG1104), mRNA 
NM_130526.2  CG3655-RA (CG3655), mRNA 
13  NM_206295.1  CG33275-RB, transcript variant B (CG33275), mRNA 
13  NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
NM_167427.1  CG9053-RB, transcript variant B (CG9053), mRNA 
NM_206293.1  CG33275-RC, transcript variant C (CG33275), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.