National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2005R-1 
 Symbol Ptp99A  Full Name Protein tyrosine phosphatase 99A 
 CG No CG11516  Old CG No CG2005 
 Synonyms DPTP99A, CT6383, R-PTP 99A, CG11516, CG2005, PTP99A, dptp99A, DPTP[[99A]], CG11515, CG11517, Ptp99A 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCCCACCAACTCCTCCAAC 
 Primer Seq. 3'
aatctagaggtaccTTCTTTGGCGGATGCCAGGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGCCCACCA ACTCCTCCAA CTCGCCATCG TCGCCATCGC CCTTCACCGT CGCCTCATTG 
0061 CCGCCCACCA CTGCATCATC GTCATCATCA CCGGCGGTCA TTAGTACCAG TTCTTTCGAT 
0121 CGCAATCTGG CCGATCTAGT CAATCCGGAG GCCGAAACAT CCGGATCCGG CTGGGAATCA 
0181 CTTGAGACTG AATTCAATCT GGCCACCACT GTGGACAGCA GCACCCAGAA GACGGCAAAG 
0241 GAACCGGTGC TGGGCACCGN AGCCACCTCC ATTGAGCAGC AGGATCAGCC GCCGGATGTG 
0301 CCAGCCACCA CGTTGGCCTT CGCCAATGCG TTTCCGGTTC CGGTGGCCGG AGAAATGGGA 
0361 AACGGAAATG GCAACTATAA CGATGCCACG CCCCCGTACG CAGCGGTCGA CGACAATTAT 
0421 GTGCCAAGCA AACCGCAGAA TCTAACCATC TTGGATGTTT CGGCCAACAG CATCACGATG 
0481 TCCTGGCATC CGC 
 in silico PCR Fragment
0001 ctgcccacca actcctccaa ctcgccatcg tcgccatcgc ccttcaccgc cgcctcattg 
0061 ccgcccacca ctgcatcgtc gtcatcatca ccggcggtca ttagtaccag ttcttccgat 
0121 cgcaatctgg ccgatctagt caatccggag gccgaaacaa ccggatccgg ctgggaatca 
0181 cttgagactg aattcaatct ggccaccact gtggacagca gcacccagaa gacggaaaag 
0241 gagccggtgc tgggcaccgt agccacctcc attgagcagc aggatcagcc gccggatgtg 
0301 ccagccacca cgttggcctt cgccaatgcg tttccggttc cggtggccgg cgaaatggga 
0361 aacggaaatg gcaactataa cgatgccacg cccccgtacg cagcggtcga cgacaattat 
0421 gtgccaagca aaccgcagaa tctaaccatc ttggatgttt cggccaacag catcacgatg 
0481 tcctggcatc cgccaaagaa  
 Assemble Data

2005R-1.IR full       1   CTGCCCACCAACTCCTCCAACTCGCCATCGTCGCCATCGCCCTTCACCGTCGCCTCATTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
2005R-1.in silico     1   CTGCCCACCAACTCCTCCAACTCGCCATCGTCGCCATCGCCCTTCACCGCCGCCTCATTG 60


2005R-1.IR full       61  CCGCCCACCACTGCATCATCGTCATCATCACCGGCGGTCATTAGTACCAGTTCTTTCGAT 120
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||
2005R-1.in silico     61  CCGCCCACCACTGCATCGTCGTCATCATCACCGGCGGTCATTAGTACCAGTTCTTCCGAT 120


2005R-1.IR full       121 CGCAATCTGGCCGATCTAGTCAATCCGGAGGCCGAAACATCCGGATCCGGCTGGGAATCA 180
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
2005R-1.in silico     121 CGCAATCTGGCCGATCTAGTCAATCCGGAGGCCGAAACAACCGGATCCGGCTGGGAATCA 180


2005R-1.IR full       181 CTTGAGACTGAATTCAATCTGGCCACCACTGTGGACAGCAGCACCCAGAAGACGGCAAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
2005R-1.in silico     181 CTTGAGACTGAATTCAATCTGGCCACCACTGTGGACAGCAGCACCCAGAAGACGGAAAAG 240


2005R-1.IR full       241 GAACCGGTGCTGGGCACCGNAGCCACCTCCATTGAGCAGCAGGATCAGCCGCCGGATGTG 300
                          || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
2005R-1.in silico     241 GAGCCGGTGCTGGGCACCGTAGCCACCTCCATTGAGCAGCAGGATCAGCCGCCGGATGTG 300


2005R-1.IR full       301 CCAGCCACCACGTTGGCCTTCGCCAATGCGTTTCCGGTTCCGGTGGCCGGAGAAATGGGA 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
2005R-1.in silico     301 CCAGCCACCACGTTGGCCTTCGCCAATGCGTTTCCGGTTCCGGTGGCCGGCGAAATGGGA 360


2005R-1.IR full       361 AACGGAAATGGCAACTATAACGATGCCACGCCCCCGTACGCAGCGGTCGACGACAATTAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2005R-1.in silico     361 AACGGAAATGGCAACTATAACGATGCCACGCCCCCGTACGCAGCGGTCGACGACAATTAT 420


2005R-1.IR full       421 GTGCCAAGCAAACCGCAGAATCTAACCATCTTGGATGTTTCGGCCAACAGCATCACGATG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2005R-1.in silico     421 GTGCCAAGCAAACCGCAGAATCTAACCATCTTGGATGTTTCGGCCAACAGCATCACGATG 480


2005R-1.IR full       481 TCCTGGCATCCGC------- 500
                          |||||||||||||       
2005R-1.in silico     481 TCCTGGCATCCGCCAAAGAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_206579.1  Protein tyrosine phosphatase 99A CG2005-RC, transcript variant C (Ptp99A), mRNA 
100  482  NM_170409.1  Protein tyrosine phosphatase 99A CG2005-RA, transcript variant A (Ptp99A), mRNA 
100  482  NM_057468.2  Protein tyrosine phosphatase 99A CG2005-RB, transcript variant B (Ptp99A), mRNA 
100  482  NM_001014683.1  Protein tyrosine phosphatase 99A CG2005-RD, transcript variant D (Ptp99A), mRNA 
12.86  62  NM_001043332.1  Protein tyrosine phosphatase 99A CG2005-RE, transcript variant E (Ptp99A), mRNA 
NM_165965.1  CG3884-RA, transcript variant A (CG3884), mRNA 
18  NM_140110.2  CG8108-RB, transcript variant B (CG8108), mRNA 
18  NM_168386.1  CG8108-RA, transcript variant A (CG8108), mRNA 
NM_078977.2  toutatis CG10897-RA, transcript variant A (tou), mRNA 
13  NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
13  NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
NM_132516.2  inaF CG2457-RA (inaF), mRNA 
NM_141323.1  CG2097-RA (CG2097), mRNA 
11  NM_001014525.1  CG33528-RD, transcript variant D (CG33528), mRNA 
10  NM_078582.3  Tenascin accessory CG32659-RA (Ten-a), mRNA 
NM_001014526.1  CG33528-RE, transcript variant E (CG33528), mRNA 
NM_001014524.1  CG33528-RC, transcript variant C (CG33528), mRNA 
NM_131954.1  CG7024-RA (CG7024), mRNA 
24  NM_132831.1  CG8184-RB (CG8184), mRNA 
11  NM_136882.2  jelly belly CG30040-RA (jeb), mRNA 
NM_164887.1  CG31714-RA (CG31714), mRNA 
NM_143513.1  CG7950-RA, transcript variant A (CG7950), mRNA 
NM_170464.1  CG7950-RB, transcript variant B (CG7950), mRNA 
NM_141433.2  CG1104-RA, transcript variant A (CG1104), mRNA 
NM_169165.1  CG1104-RB, transcript variant B (CG1104), mRNA 
NM_130526.2  CG3655-RA (CG3655), mRNA 
13  NM_206295.1  CG33275-RB, transcript variant B (CG33275), mRNA 
13  NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
NM_167427.1  CG9053-RB, transcript variant B (CG9053), mRNA 
NM_206293.1  CG33275-RC, transcript variant C (CG33275), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.