National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18769R-2 
 Symbol CG18769  Full Name CG18769 
 CG No CG18769  Old CG No CG18769 
 Synonyms CG8352, CG18769 
 Accession No (Link to NCBI) NM_144449.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATAGAAGTCTCGCCCTGCGTT 
 Primer Seq. 3'
aatctagaggtaccGTTGAATGCCTCGTAGAGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATAGAAGTCT CGCCCTGCGT TTGGCCCCCG GcACCACCTT CGCCCTGCAC TTACGGCCAT 
0061 GTCATGAGCT TCAGCAGCAC AGAAGCTTCN CATCCACGGC GGAGGATGGC GAAACGGACA 
0121 AGCATAAAAA ACCGACGACG GGAGNAAGAC ATCTATGTGG AATACGTGAA TGGCATGCCA 
0181 CACATGACTG TACGACTTCC CAGTCGCAAT GAACTCTGCC AGTTTGCCCT GAAACCCATC 
0241 TCCCACAACG TTGGTGATCT GTTAGCCATG CTCAGGGCTG AGGATCGGGG CATCGATCGA 
0301 GCTGCGGTGA TCAACAAGCA TGGTGTGCGA ATCGCGTCGT CCTGCACCAT CGAAAGCTTG 
0361 CTGGATGACT CGTTTAGCAT ACAAATCAAC AATCGCACAT TGGATGTGAA TCCTCCCAAA 
0421 CGTGACAAAG TCACATTGGA GTCCATGGAC AAAGTGGGCG ATGTTCGTAA GGTTATTGCT 
0481 CAGcTCTACG AGGCATTCAA C 
 in silico PCR Fragment
0001 ATAGAAGTCT CGCCCTGCGT TTGGCCCCCG GCACCACCTT CGCCCTGCAC TTACGGCCAT 
0061 GTCATGAGCT TCAGCAGCAC AGAAGCTTCG CATCCACGGC GGAGGATGGC GAAACGGACA 
0121 AGCATAAAAA ACCGACGACG GGAG-AAGAC ATCTATGTGG AATACGTGAA TGGCATGCCA 
0181 CACATGACTG TACGACTTCC CAGTCGCAAT GAACTCTGCC AGTTTGCCCT GAAACCCATC 
0241 TCCCACAACG TTGGTGATCT GTTAGCCATG CTCAGGGCTG AGGATCGGGG CATCGATCGA 
0301 GCTGCGGTGA TCAACAAGCA TGGTGTGCGA ATCGCGTCGT CCTGCACCAT CGAAAGCTTG 
0361 CTGGATGACT CGTTTAGCAT ACAAATCAAC AATCGCACAT TGGATGTGAA TCCTCCCAAA 
0421 CGTGACAAAG TCACATTGGA GTCCATGGAC AAAGTGGGCG ATGTTCGTAA GGTTATTGCT 
0481 CAGCTCTACG AGGCATTCAA C 
 Assemble Data

18769R-2.IR_full       1   ATAGAAGTCTCGCCCTGCGTTTGGCCCCCGGCACCACCTTCGCCCTGCACTTACGGCCAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18769R-2.in silico     1   ATAGAAGTCTCGCCCTGCGTTTGGCCCCCGGCACCACCTTCGCCCTGCACTTACGGCCAT 60


18769R-2.IR_full       61  GTCATGAGCTTCAGCAGCACAGAAGCTTCNCATCCACGGCGGAGGATGGCGAAACGGACA 120
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
18769R-2.in silico     61  GTCATGAGCTTCAGCAGCACAGAAGCTTCGCATCCACGGCGGAGGATGGCGAAACGGACA 120


18769R-2.IR_full       121 AGCATAAAAAACCGACGACGGGAGNAAGACATCTATGTGGAATACGTGAATGGCATGCCA 180
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
18769R-2.in silico     121 AGCATAAAAAACCGACGACGGGAG-AAGACATCTATGTGGAATACGTGAATGGCATGCCA 180


18769R-2.IR_full       181 CACATGACTGTACGACTTCCCAGTCGCAATGAACTCTGCCAGTTTGCCCTGAAACCCATC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18769R-2.in silico     181 CACATGACTGTACGACTTCCCAGTCGCAATGAACTCTGCCAGTTTGCCCTGAAACCCATC 240


18769R-2.IR_full       241 TCCCACAACGTTGGTGATCTGTTAGCCATGCTCAGGGCTGAGGATCGGGGCATCGATCGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18769R-2.in silico     241 TCCCACAACGTTGGTGATCTGTTAGCCATGCTCAGGGCTGAGGATCGGGGCATCGATCGA 300


18769R-2.IR_full       301 GCTGCGGTGATCAACAAGCATGGTGTGCGAATCGCGTCGTCCTGCACCATCGAAAGCTTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18769R-2.in silico     301 GCTGCGGTGATCAACAAGCATGGTGTGCGAATCGCGTCGTCCTGCACCATCGAAAGCTTG 360


18769R-2.IR_full       361 CTGGATGACTCGTTTAGCATACAAATCAACAATCGCACATTGGATGTGAATCCTCCCAAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18769R-2.in silico     361 CTGGATGACTCGTTTAGCATACAAATCAACAATCGCACATTGGATGTGAATCCTCCCAAA 420


18769R-2.IR_full       421 CGTGACAAAGTCACATTGGAGTCCATGGACAAAGTGGGCGATGTTCGTAAGGTTATTGCT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18769R-2.in silico     421 CGTGACAAAGTCACATTGGAGTCCATGGACAAAGTGGGCGATGTTCGTAAGGTTATTGCT 480


18769R-2.IR_full       481 CAGCTCTACGAGGCATTCAAC 501
                           |||||||||||||||||||||
18769R-2.in silico     481 CAGCTCTACGAGGCATTCAAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168169.2  CG18769-RB, transcript variant B (CG18769), mRNA 
100   482  NM_206282.1  CG18769-RD, transcript variant D (CG18769), mRNA 
100   482  NM_168170.1  CG18769-RC, transcript variant C (CG18769), mRNA 
100   482  NM_144449.2  CG18769-RA, transcript variant A (CG18769), mRNA 
90.45   436  NM_206281.1  CG18769-RE, transcript variant E (CG18769), mRNA 
70.33   339  NM_206280.1  CG18769-RF, transcript variant F (CG18769), mRNA 
0   NM_135624.2  CG7309-RA (CG7309), mRNA 
0   NM_078867.2  CG5526-RA (Dhc36C), mRNA 
0   NM_136835.2  CG9035-RA (Tapdelta), mRNA 
0   NM_167045.1  CG32758-RA (CG32758), mRNA 
0   NM_132614.2  CG4396-RA (fne), mRNA 
0   NM_206488.1  CG3563-RB, transcript variant B (CG3563), mRNA 
0   NM_142132.2  CG3563-RA, transcript variant A (CG3563), mRNA 
0   NM_144367.1  CG6633-RA (Ugt86Dd), mRNA 
0   NM_166077.1  CG12424-RC, transcript variant C (CG12424), mRNA 
0   NM_137165.1  CG12424-RA, transcript variant A (CG12424), mRNA 
0   NM_166076.1  CG12424-RB, transcript variant B (CG12424), mRNA 
0   NM_143555.2  CG9717-RA (CG9717), mRNA 
0   NM_143515.1  CG9753-RA (AdoR), mRNA 
0   NM_079001.2  CG3886-RA (Psc), mRNA 
0   NM_165611.1  CG8643-RA (rgr), mRNA 
0   NM_206616.1  CG2658-RB, transcript variant B (CG2658), mRNA 
0   NM_130661.1  CG2658-RA, transcript variant A (CG2658), mRNA 
0   NM_001014526.1  CG33528-RE, transcript variant E (CG33528), mRNA 
0   NM_137036.2  CG13330-RA (CG13330), mRNA 
0   NM_133036.1  CG15373-RA (CG15373), mRNA 
0   NM_135895.2  CG15269-RA (CG15269), mRNA 
0   NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   11  NM_057842.2  CG16858-RA (vkg), mRNA 
0   NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.