National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18660R-3 
 Symbol Nckx30C  Full Name Nckx30C 
 CG No CG18660  Old CG No CG18660 
 Synonyms CG4106, potassium-dependent sodium/calcium, CG18660, Nckx30C 
 Accession No (Link to NCBI) NM_164869.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| silico     1   GCAATCGCAACAGCAGCAGTGGGTGGAGCAGCGGTCCAGGAGCTGCTTCGGAA-AGCCGC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGCTAAAGATCATGGAGCCTTAGCAGCAGCAACTGCAACAGCAACAGCAGCATCAACAAC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGCAACAACTGCAACAGCAGCAACAGCAAGCCGCAACAGCAGCAACACTTGGTGCCACAG 180

                           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     181 CGACGACATGTTGTCCGCAGGCCGCA-GCCGCAGCAGCAGCACAACGATAGACTTCAATA 240

                           ||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||| silico     241 GTCGCCGGCGGAGGGGGCGCCTACGAGGCCACGCCCCCAGTGACCTGGCAATGAACAAGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACACCAAGCTACGATACTGGACGAGTGTGTAAATATTTTCAAGCGCTTAGTATTATTAA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CATTAAAAACAATATCAGCAACAACAATAACGAAAGCAAAGACAAGAAGCAGAACAGCAG 420

                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGCAGCTA-CCAGCAACATCTGCAGCATCTGCAACATCATCTCGTGGTGCCTCCGCGGAG 480

18660R-3.IR_full       481 CAATTGCTCCACCCAAGTANGCCG 504
                           ||||||||||||||||||| |||| silico     481 CAATTGCTCCACCCAAGTA-GCCG 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  70  241  NM_143754.2  CG18660-RC, transcript variant C (Nckx30C), mRNA 
100   482  70  241  NM_164870.1  CG18660-RB, transcript variant B (Nckx30C), mRNA 
100   482  70  241  NM_164869.1  CG18660-RA, transcript variant A (Nckx30C), mRNA 
2.48   12  40  145  NM_135607.2  CG6495-RA (CG6495), mRNA 
1.65   11  72  264  NM_168039.1  CG32264-RB, transcript variant B (CG32264), mRNA 
1.24   30  133  409  NM_137081.2  CG30483-RA (Prosap), mRNA 
1.24   33  160  NM_168758.2  CG32193-RA (CG32193), mRNA 
0.82   31  126  374  NM_078530.2  CG11202-RA (org-1), mRNA 
0.82   26  112  408  NM_001014517.1  CG2368-RL, transcript variant L (psq), mRNA 
0.82   26  112  408  NM_001014520.1  CG2368-RI, transcript variant I (psq), mRNA 
0.82   26  112  408  NM_078962.2  CG2368-RB, transcript variant B (psq), mRNA 
0.82   26  112  408  NM_165790.1  CG2368-RA, transcript variant A (psq), mRNA 
0.82   26  112  407  NM_176143.1  CG2368-RH, transcript variant H (psq), mRNA 
0.82   26  112  407  NM_165791.1  CG2368-RD, transcript variant D (psq), mRNA 
0.82   26  112  407  NM_206086.1  CG2368-RC, transcript variant C (psq), mRNA 
0.82   26  112  407  NM_001014518.1  CG2368-RK, transcript variant K (psq), mRNA 
0.82   26  112  407  NM_176141.1  CG2368-RF, transcript variant F (psq), mRNA 
0.82   26  112  407  NM_176142.1  CG2368-RG, transcript variant G (psq), mRNA 
0.82   26  112  407  NM_165792.1  CG2368-RE, transcript variant E (psq), mRNA 
0.82   26  112  407  NM_001014519.1  CG2368-RJ, transcript variant J (psq), mRNA 
0.82   16  71  243  NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0.82   16  70  223  NM_170522.2  CG1322-RC, transcript variant C (zfh1), mRNA 
0.82   12  56  204  NM_142817.1  CG17622-RA (CG17622), mRNA 
0.82   110  476  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0.62   18  157  496  NM_135954.1  CG13260-RA (CG13260), mRNA 
0.62   27  107  NM_001043271.1  CG17299-RL, transcript variant L (SNF4Agamma), mRNA 
0.62   27  107  NM_169950.1  CG17299-RG, transcript variant G (SNF4Agamma), mRNA 
0.41   43  171  458  NM_143765.2  CG12218-RA (mei-P26), mRNA 
0.41   30  83  239  NM_144262.1  CG12683-RA (CG12683), mRNA 
0.41   19  118  424  NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.