National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18660R-1 
 Symbol Nckx30C  Full Name Nckx30C 
 CG No CG18660  Old CG No CG18660 
 Synonyms CG4106, potassium-dependent sodium/calcium, CG18660, Nckx30C 
 Accession No (Link to NCBI) NM_164869.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAATCGCAACAGCAGCAGTG 
 Primer Seq. 3'
aatctagaggtaccCGGCTACTTGGGTGGAGCAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCAATCGCAA CAGCAGCAGT GGGTGGAGCA GCGGTCCAGG AGCTGCTTCG GAANAGCCGC 
0061 AGCTAAAGAT CATGGAGCCT TAGCAGCAGC AACTGCAACA GCAACAGCAG CATCAACAAC 
0121 TGCAACAACT GCAACAGCAG CAACAGCAAG CCGCAACAGC AGCAACACTT GGTGCCACAG 
0181 CGACGACATG TTGTCCGCAG GCCGCANGCC GCAGCAGCAG CACAACGATA GACTTCAATA 
0241 GTCGCCGGCG GAGGGGGCGC CTACGAGGCC ACGCCCCCTT TGACCTGGCA ATGAACAAGC 
0301 AACACCAAGC TACGATACTG GACGAGTGTG TAAATATTTT CAAGCGCTTA GTATTATTAA 
0361 CATTAAAAAC AATATCAGCA ACAACAATAA CGAAAGCAAA GACAAGAAGC AGAACAGCAG 
0421 cGCAGCTACC CAGCAACATC TGCAGCATCT GCAACATCAT CTCGTGGTGC CTCCGCGGAG 
0481 CAATTGCTCC ACCCAAGTAN GCCG 
 in silico PCR Fragment
0001 GCAATCGCAA CAGCAGCAGT GGGTGGAGCA GCGGTCCAGG AGCTGCTTCG GAA-AGCCGC 
0061 AGCTAAAGAT CATGGAGCCT TAGCAGCAGC AACTGCAACA GCAACAGCAG CATCAACAAC 
0121 TGCAACAACT GCAACAGCAG CAACAGCAAG CCGCAACAGC AGCAACACTT GGTGCCACAG 
0181 CGACGACATG TTGTCCGCAG GCCGCA-GCC GCAGCAGCAG CACAACGATA GACTTCAATA 
0241 GTCGCCGGCG GAGGGGGCGC CTACGAGGCC ACGCCCCCAG TGACCTGGCA ATGAACAAGC 
0301 AACACCAAGC TACGATACTG GACGAGTGTG TAAATATTTT CAAGCGCTTA GTATTATTAA 
0361 CATTAAAAAC AATATCAGCA ACAACAATAA CGAAAGCAAA GACAAGAAGC AGAACAGCAG 
0421 CGCAGCTA-C CAGCAACATC TGCAGCATCT GCAACATCAT CTCGTGGTGC CTCCGCGGAG 
0481 CAATTGCTCC ACCCAAGTA- GCCG 
 Assemble Data

18660R-1.IR_full       1   GCAATCGCAACAGCAGCAGTGGGTGGAGCAGCGGTCCAGGAGCTGCTTCGGAANAGCCGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
18660R-1.in silico     1   GCAATCGCAACAGCAGCAGTGGGTGGAGCAGCGGTCCAGGAGCTGCTTCGGAA-AGCCGC 60


18660R-1.IR_full       61  AGCTAAAGATCATGGAGCCTTAGCAGCAGCAACTGCAACAGCAACAGCAGCATCAACAAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18660R-1.in silico     61  AGCTAAAGATCATGGAGCCTTAGCAGCAGCAACTGCAACAGCAACAGCAGCATCAACAAC 120


18660R-1.IR_full       121 TGCAACAACTGCAACAGCAGCAACAGCAAGCCGCAACAGCAGCAACACTTGGTGCCACAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18660R-1.in silico     121 TGCAACAACTGCAACAGCAGCAACAGCAAGCCGCAACAGCAGCAACACTTGGTGCCACAG 180


18660R-1.IR_full       181 CGACGACATGTTGTCCGCAGGCCGCANGCCGCAGCAGCAGCACAACGATAGACTTCAATA 240
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
18660R-1.in silico     181 CGACGACATGTTGTCCGCAGGCCGCA-GCCGCAGCAGCAGCACAACGATAGACTTCAATA 240


18660R-1.IR_full       241 GTCGCCGGCGGAGGGGGCGCCTACGAGGCCACGCCCCCTTTGACCTGGCAATGAACAAGC 300
                           ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
18660R-1.in silico     241 GTCGCCGGCGGAGGGGGCGCCTACGAGGCCACGCCCCCAGTGACCTGGCAATGAACAAGC 300


18660R-1.IR_full       301 AACACCAAGCTACGATACTGGACGAGTGTGTAAATATTTTCAAGCGCTTAGTATTATTAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18660R-1.in silico     301 AACACCAAGCTACGATACTGGACGAGTGTGTAAATATTTTCAAGCGCTTAGTATTATTAA 360


18660R-1.IR_full       361 CATTAAAAACAATATCAGCAACAACAATAACGAAAGCAAAGACAAGAAGCAGAACAGCAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18660R-1.in silico     361 CATTAAAAACAATATCAGCAACAACAATAACGAAAGCAAAGACAAGAAGCAGAACAGCAG 420


18660R-1.IR_full       421 CGCAGCTACCCAGCAACATCTGCAGCATCTGCAACATCATCTCGTGGTGCCTCCGCGGAG 480
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
18660R-1.in silico     421 CGCAGCTA-CCAGCAACATCTGCAGCATCTGCAACATCATCTCGTGGTGCCTCCGCGGAG 480


18660R-1.IR_full       481 CAATTGCTCCACCCAAGTANGCCG 504
                           ||||||||||||||||||| ||||
18660R-1.in silico     481 CAATTGCTCCACCCAAGTA-GCCG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  70  241  NM_143754.2  CG18660-RC, transcript variant C (Nckx30C), mRNA 
100   482  70  241  NM_164870.1  CG18660-RB, transcript variant B (Nckx30C), mRNA 
100   482  70  241  NM_164869.1  CG18660-RA, transcript variant A (Nckx30C), mRNA 
2.48   12  40  145  NM_135607.2  CG6495-RA (CG6495), mRNA 
1.65   11  72  264  NM_168039.1  CG32264-RB, transcript variant B (CG32264), mRNA 
1.24   30  133  409  NM_137081.2  CG30483-RA (Prosap), mRNA 
1.24   33  160  NM_168758.2  CG32193-RA (CG32193), mRNA 
0.82   31  126  374  NM_078530.2  CG11202-RA (org-1), mRNA 
0.82   26  112  408  NM_001014517.1  CG2368-RL, transcript variant L (psq), mRNA 
0.82   26  112  408  NM_001014520.1  CG2368-RI, transcript variant I (psq), mRNA 
0.82   26  112  408  NM_078962.2  CG2368-RB, transcript variant B (psq), mRNA 
0.82   26  112  408  NM_165790.1  CG2368-RA, transcript variant A (psq), mRNA 
0.82   26  112  407  NM_176143.1  CG2368-RH, transcript variant H (psq), mRNA 
0.82   26  112  407  NM_165791.1  CG2368-RD, transcript variant D (psq), mRNA 
0.82   26  112  407  NM_206086.1  CG2368-RC, transcript variant C (psq), mRNA 
0.82   26  112  407  NM_001014518.1  CG2368-RK, transcript variant K (psq), mRNA 
0.82   26  112  407  NM_176141.1  CG2368-RF, transcript variant F (psq), mRNA 
0.82   26  112  407  NM_176142.1  CG2368-RG, transcript variant G (psq), mRNA 
0.82   26  112  407  NM_165792.1  CG2368-RE, transcript variant E (psq), mRNA 
0.82   26  112  407  NM_001014519.1  CG2368-RJ, transcript variant J (psq), mRNA 
0.82   16  71  243  NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0.82   16  70  223  NM_170522.2  CG1322-RC, transcript variant C (zfh1), mRNA 
0.82   12  56  204  NM_142817.1  CG17622-RA (CG17622), mRNA 
0.82   110  476  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0.62   18  157  496  NM_135954.1  CG13260-RA (CG13260), mRNA 
0.62   27  107  NM_001043271.1  CG17299-RL, transcript variant L (SNF4Agamma), mRNA 
0.62   27  107  NM_169950.1  CG17299-RG, transcript variant G (SNF4Agamma), mRNA 
0.41   43  171  458  NM_143765.2  CG12218-RA (mei-P26), mRNA 
0.41   30  83  239  NM_144262.1  CG12683-RA (CG12683), mRNA 
0.41   19  118  424  NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.