National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18659R-4 
 Symbol CG18659  Full Name CG18659 
 CG No CG18659  Old CG No CG18659 
 Synonyms BcDNA:GH08789, CG8059, CG30348, CG30347, anon-WO0118547.145, anon-WO0118547.140, CG18659 
 Accession No (Link to NCBI) NM_145873.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACGTGAAGAAGCTCTTCGAG 
 Primer Seq. 3'
aatctagaggtaccATGCTGGGCAACTGGAACTGC 
 Predicted Fragment Size
506 
 IR fragment full Seq
0001 GACGTGAAGA AGCTCTTCGA GTTCTGGTGC GAGGTCACGC CGACGCCGGG ATTAGAGAGG 
0061 GGCACGAGTT CCAGGAGCGG CGGGCCAGCT GTTCCCGCCG GCGTGATCGT GGAGAGCTTC 
0121 CCCGAGGGAT TCCGCGACCA GGAGGTGCTC ACCGGCATCC CATCGTTTGC CTTTCCCTGC 
0181 GACACAACAA GCACCTCGGT GCAGACATAT TCCTTTGTGC ACACCACTGG CGATTCGAAA 
0241 TGGCGCTTCG GCTTCTGTCG ACAGGATCCG NGGACGAACA CGGCCATGGT GCTGATAACC 
0301 TACCTGCCGT GGCACGACAC CTTCCTAAAG CTGCTGCCCG TGCTCGCCGA GCTGAGGCGG 
0361 ACGGATCCCA ATGGGTTTCG CACCTTCCTC TCCGAGGCCT ACAACCAGGG TATCCCGGAT 
0421 TGTGGCGGCA GCCTTAAAGT CTATTACAGC GCAGGCCAGA GTCACTTCAC CTTCGAACGC 
0481 CCACTGCAGT TCCAGTTGCC CAGCAT 
 in silico PCR Fragment
0001 GACGTGAAGA AGCTCTTCGA GTTCTGGTGC GAGGTCACGC CGACGCCGGG ATTAGAGAGG 
0061 GGCACGAGTT CCAGGAGCGG CGGGCCAGCT GTTCCCGCCG GCGTGATCGT GGAGAGCTTC 
0121 CCCGAGGGAT TCCGCGACCA GGAGGTGCTC ACCGGCATCC CATCGTTTGC CTTTCCCTGC 
0181 GACACAACAA GCACCTCGGT GCAGACATAT TCCTTTGTGC ACACCACTGG CGATTCGAAA 
0241 TGGCGCTTCG GCTTCTGTCG ACAGGATCCG CGGACGAACA CGGCCATGGT GCTGATAACC 
0301 TACCTGCCGT GGCACGACAC CTTCCTAAAG CTGCTGCCCG TGCTCGCCGA GCTGAGGCGG 
0361 ACGGATCCCA ATGGGTTTCG CACCTTCCTC TCCGAGGCCT ACAACCAGGG TATCCCGGAT 
0421 TGTGGCGGCA GCCTTAAAGT CTATTACAGC GCAGGCCAGA GTCACTTCAC CTTCGAACGC 
0481 CCACTGCAGT TCCAGTTGCC CAGCAT 
 Assemble Data

18659R-4.IR_full       1   GACGTGAAGAAGCTCTTCGAGTTCTGGTGCGAGGTCACGCCGACGCCGGGATTAGAGAGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18659R-4.in silico     1   GACGTGAAGAAGCTCTTCGAGTTCTGGTGCGAGGTCACGCCGACGCCGGGATTAGAGAGG 60


18659R-4.IR_full       61  GGCACGAGTTCCAGGAGCGGCGGGCCAGCTGTTCCCGCCGGCGTGATCGTGGAGAGCTTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18659R-4.in silico     61  GGCACGAGTTCCAGGAGCGGCGGGCCAGCTGTTCCCGCCGGCGTGATCGTGGAGAGCTTC 120


18659R-4.IR_full       121 CCCGAGGGATTCCGCGACCAGGAGGTGCTCACCGGCATCCCATCGTTTGCCTTTCCCTGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18659R-4.in silico     121 CCCGAGGGATTCCGCGACCAGGAGGTGCTCACCGGCATCCCATCGTTTGCCTTTCCCTGC 180


18659R-4.IR_full       181 GACACAACAAGCACCTCGGTGCAGACATATTCCTTTGTGCACACCACTGGCGATTCGAAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18659R-4.in silico     181 GACACAACAAGCACCTCGGTGCAGACATATTCCTTTGTGCACACCACTGGCGATTCGAAA 240


18659R-4.IR_full       241 TGGCGCTTCGGCTTCTGTCGACAGGATCCGNGGACGAACACGGCCATGGTGCTGATAACC 300
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
18659R-4.in silico     241 TGGCGCTTCGGCTTCTGTCGACAGGATCCGCGGACGAACACGGCCATGGTGCTGATAACC 300


18659R-4.IR_full       301 TACCTGCCGTGGCACGACACCTTCCTAAAGCTGCTGCCCGTGCTCGCCGAGCTGAGGCGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18659R-4.in silico     301 TACCTGCCGTGGCACGACACCTTCCTAAAGCTGCTGCCCGTGCTCGCCGAGCTGAGGCGG 360


18659R-4.IR_full       361 ACGGATCCCAATGGGTTTCGCACCTTCCTCTCCGAGGCCTACAACCAGGGTATCCCGGAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18659R-4.in silico     361 ACGGATCCCAATGGGTTTCGCACCTTCCTCTCCGAGGCCTACAACCAGGGTATCCCGGAT 420


18659R-4.IR_full       421 TGTGGCGGCAGCCTTAAAGTCTATTACAGCGCAGGCCAGAGTCACTTCACCTTCGAACGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18659R-4.in silico     421 TGTGGCGGCAGCCTTAAAGTCTATTACAGCGCAGGCCAGAGTCACTTCACCTTCGAACGC 480


18659R-4.IR_full       481 CCACTGCAGTTCCAGTTGCCCAGCAT 506
                           ||||||||||||||||||||||||||
18659R-4.in silico     481 CCACTGCAGTTCCAGTTGCCCAGCAT 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   488  NM_145873.2  CG18659-RA, transcript variant A (CG18659), mRNA 
0   10  NM_001042789.1  CG13366-RB, transcript variant B (CG13366), mRNA 
0   10  NM_130492.2  CG13366-RA, transcript variant A (CG13366), mRNA 
0   NM_166099.1  CG8182-RB, transcript variant B (GalNAc-T1), mRNA 
0   NM_137199.2  CG8182-RA, transcript variant A (GalNAc-T1), mRNA 
0   NM_079161.2  CG13927-RA (GC), mRNA 
0   NM_143517.1  CG11498-RA (CG11498), mRNA 
0   NM_143717.1  CG10840-RB (eIF5B), mRNA 
0   NM_206581.1  CG2304-RC, transcript variant C (Trc8), mRNA 
0   NM_170413.2  CG2304-RA, transcript variant A (Trc8), mRNA 
0   NM_170414.1  CG2304-RB, transcript variant B (Trc8), mRNA 
0   NM_206580.1  CG2304-RD, transcript variant D (Trc8), mRNA 
0   NM_132508.2  CG1703-RA (CG1703), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_176165.1  CG33156-RA, transcript variant A (CG33156), mRNA 
0   NM_176168.1  CG33156-RC, transcript variant C (CG33156), mRNA 
0   NM_144472.2  CG1898-RA (HBS1), mRNA 
0   NM_143321.2  CG5590-RA (CG5590), mRNA 
0   NM_134665.2  CG3345-RA (CG3345), mRNA 
0   NM_079798.2  CG5507-RA (T48), mRNA 
0   NM_132640.2  CG1770-RA, transcript variant A (HDAC4), mRNA 
0   NM_001014736.1  CG1770-RC, transcript variant C (HDAC4), mRNA 
0   NM_167356.1  CG1770-RB, transcript variant B (HDAC4), mRNA 
0   NM_142165.2  CG6904-RB, transcript variant B (CG6904), mRNA 
0   NM_169611.1  CG6904-RC, transcript variant C (CG6904), mRNA 
0   NM_169610.1  CG6904-RA, transcript variant A (CG6904), mRNA 
0   NM_057511.3  CG3936-RA (N), mRNA 
0   NM_164454.1  CG31671-RA (tho2), mRNA 
0   NM_134677.1  CG13690-RA (CG13690), mRNA 
0   NM_168039.1  CG32264-RB, transcript variant B (CG32264), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.