National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18657R-2 
 Symbol NetA  Full Name Netrin-A 
 CG No CG18657  Old CG No CG18657 
 Synonyms netA, CT27014, CG18657, NetA 
 Accession No (Link to NCBI) NM_078599.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | silico     1   CGTGGAATCTTGCTCCTGCTGCTGGGAACCACCAGGTTCAGCCCCATCCAGTGCATCTCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AATGACGTGTACTTCAAGATGTTTTCGCAACAGGCGCCGCCGGAGGATCCGTGCTACAAT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAAGCGCACGAGCCACGCGCCTGCATTCCGGACTTTGTGAACGCCGCCTACGATGCTCCA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTGGTGGCCAGTTCCACGTGCGGATCGTCGGGTGCGCAGCGATATTGCGAGTACCAGGAT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CACGAGCGCTCCTGCCACACCTGCGACATGACGGATCCGTTGCGCAGCTTTCCAGCCCGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCGCTGACCGATTTGAATAACTCGAATAATGTGACCTGCTGGCGCAGTGAGCCGGTGACC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGAAGTGGGGACAACGTAACCTTGACCCTCTCGCTGGGCAAGAAGTTCGAGCTGACCTAT 420

                           |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     421 GTGATCCTACAGCTGTGCCCGCATGCTC-CGCGTCCCGATTCGATGGTGATCTACAAGAG 480

18657R-2.IR_full       481 CACCGATCACGGGCTCAGTTG 501
                           ||||||||||||||||||||| silico     481 CACCGATCACGGGCTCAGTTG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078599.3  CG18657-RA (NetA), mRNA 
0.41   NM_137130.2  CG10131-RA (CG10131), mRNA 
0   16  17  12  NM_078600.2  CG10521-RA (NetB), mRNA 
0   NM_001015336.1  CG40380-PA.3 (CG40380), mRNA 
0   NM_136446.2  CG1603-RA (CG1603), mRNA 
0   NM_165041.1  CG6866-RA, transcript variant A (loqs), mRNA 
0   NM_135802.2  CG6866-RB, transcript variant B (loqs), mRNA 
0   NM_001038814.1  CG6866-RC, transcript variant C (loqs), mRNA 
0   NM_001043132.1  CG3689-RC, transcript variant C (CG3689), mRNA 
0   NM_140051.2  CG3689-RB, transcript variant B (CG3689), mRNA 
0   NM_170089.1  CG10367-RA, transcript variant A (Hmgcr), mRNA 
0   NM_136507.1  CG11210-RA (CG11210), mRNA 
0   NM_206548.1  CG10367-RB, transcript variant B (Hmgcr), mRNA 
0   NR_002490.1  CG10367-RB, transcript variant B (Hmgcr), mRNA, miscRNA 
0   NM_168799.1  CG32212-RA (CG32212), mRNA 
0   11  NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_130594.1  CG14803-RA (CG14803), mRNA 
0   NM_143225.2  CG6490-RA (CG6490), mRNA 
0   NM_170552.1  CG1499-RB, transcript variant B (CG1499), mRNA 
0   NM_143614.1  CG1499-RA, transcript variant A (CG1499), mRNA 
0   NM_132629.1  CG4330-RA (CG4330), mRNA 
0   NM_144289.1  CG15308-RA (CG15308), mRNA 
0   NM_142213.1  CG14870-RA (CG14870), mRNA 
0   NM_164771.2  CG7179-RA (CG7179), mRNA 
0   NM_132335.2  CG12139-RB (CG12139), mRNA 
0   NM_057757.3  CG2714-RA, transcript variant A (crm), mRNA 
0   NM_079528.2  CG2520-RA (lap), mRNA 
0   NM_166951.1  CG2714-RB, transcript variant B (crm), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_135841.4  CG8954-RA, transcript variant A (Smg5), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.