National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18657R-1 
 Symbol NetA  Full Name Netrin-A 
 CG No CG18657  Old CG No CG18657 
 Synonyms netA, CT27014, CG18657, NetA 
 Accession No (Link to NCBI) NM_078599.3 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGTGGAATCTTGCTCCTGCTG 
 Primer Seq. 3'
aatctagaggtaccCAACTGAGCCCGTGATCGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGTGGAATCT TGCTCCTGCT GCTGGGAACC ACCAGGTTCA GCCCCATCCA GTGCATCTTC 
0061 AATGACGTGT ACTTCAAGAT GTTTTCGCAA CAGGCGCCGC CGGAGGATCC GTGCTACAAT 
0121 AAAGCGCACG AGCCACGCGC CTGCATTCCG GACTTTGTGA ACGCCGCCTA CGATGCTCCA 
0181 GTGGTGGCCA GTTCCACGTG CGGATCGTCG GGTGCGCAGC GATATTGCGA GTACCAGGAT 
0241 CACGAGCGCT CCTGCCACAC CTGCGACATG ACGGATCCGT TGCGCAGCTT TCCAGCCCGC 
0301 TCGCTGACCG ATTTGAATAA CTCGAATAAT GTGACCTGCT GGCGCAGTGA GCCGGTGACC 
0361 GGAAGTGGGG ACAACGTAAC CTTGACCCTC TCGCTGGGCA AGAAGTTCGA GCTGACCTAT 
0421 GTGATCCTAC AGCTGTGCCC GCATGCTCGC GCGTCCCGAT TCGATGGTGA TCTACAAGAG 
0481 CACCGATCAC GGGCTCAGTT G 
 in silico PCR Fragment
0001 CGTGGAATCT TGCTCCTGCT GCTGGGAACC ACCAGGTTCA GCCCCATCCA GTGCATCTCC 
0061 AATGACGTGT ACTTCAAGAT GTTTTCGCAA CAGGCGCCGC CGGAGGATCC GTGCTACAAT 
0121 AAAGCGCACG AGCCACGCGC CTGCATTCCG GACTTTGTGA ACGCCGCCTA CGATGCTCCA 
0181 GTGGTGGCCA GTTCCACGTG CGGATCGTCG GGTGCGCAGC GATATTGCGA GTACCAGGAT 
0241 CACGAGCGCT CCTGCCACAC CTGCGACATG ACGGATCCGT TGCGCAGCTT TCCAGCCCGC 
0301 TCGCTGACCG ATTTGAATAA CTCGAATAAT GTGACCTGCT GGCGCAGTGA GCCGGTGACC 
0361 GGAAGTGGGG ACAACGTAAC CTTGACCCTC TCGCTGGGCA AGAAGTTCGA GCTGACCTAT 
0421 GTGATCCTAC AGCTGTGCCC GCATGCTC-C GCGTCCCGAT TCGATGGTGA TCTACAAGAG 
0481 CACCGATCAC GGGCTCAGTT G 
 Assemble Data

18657R-1.IR_full       1   CGTGGAATCTTGCTCCTGCTGCTGGGAACCACCAGGTTCAGCCCCATCCAGTGCATCTTC 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
18657R-1.in silico     1   CGTGGAATCTTGCTCCTGCTGCTGGGAACCACCAGGTTCAGCCCCATCCAGTGCATCTCC 60


18657R-1.IR_full       61  AATGACGTGTACTTCAAGATGTTTTCGCAACAGGCGCCGCCGGAGGATCCGTGCTACAAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18657R-1.in silico     61  AATGACGTGTACTTCAAGATGTTTTCGCAACAGGCGCCGCCGGAGGATCCGTGCTACAAT 120


18657R-1.IR_full       121 AAAGCGCACGAGCCACGCGCCTGCATTCCGGACTTTGTGAACGCCGCCTACGATGCTCCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18657R-1.in silico     121 AAAGCGCACGAGCCACGCGCCTGCATTCCGGACTTTGTGAACGCCGCCTACGATGCTCCA 180


18657R-1.IR_full       181 GTGGTGGCCAGTTCCACGTGCGGATCGTCGGGTGCGCAGCGATATTGCGAGTACCAGGAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18657R-1.in silico     181 GTGGTGGCCAGTTCCACGTGCGGATCGTCGGGTGCGCAGCGATATTGCGAGTACCAGGAT 240


18657R-1.IR_full       241 CACGAGCGCTCCTGCCACACCTGCGACATGACGGATCCGTTGCGCAGCTTTCCAGCCCGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18657R-1.in silico     241 CACGAGCGCTCCTGCCACACCTGCGACATGACGGATCCGTTGCGCAGCTTTCCAGCCCGC 300


18657R-1.IR_full       301 TCGCTGACCGATTTGAATAACTCGAATAATGTGACCTGCTGGCGCAGTGAGCCGGTGACC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18657R-1.in silico     301 TCGCTGACCGATTTGAATAACTCGAATAATGTGACCTGCTGGCGCAGTGAGCCGGTGACC 360


18657R-1.IR_full       361 GGAAGTGGGGACAACGTAACCTTGACCCTCTCGCTGGGCAAGAAGTTCGAGCTGACCTAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18657R-1.in silico     361 GGAAGTGGGGACAACGTAACCTTGACCCTCTCGCTGGGCAAGAAGTTCGAGCTGACCTAT 420


18657R-1.IR_full       421 GTGATCCTACAGCTGTGCCCGCATGCTCGCGCGTCCCGATTCGATGGTGATCTACAAGAG 480
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
18657R-1.in silico     421 GTGATCCTACAGCTGTGCCCGCATGCTC-CGCGTCCCGATTCGATGGTGATCTACAAGAG 480


18657R-1.IR_full       481 CACCGATCACGGGCTCAGTTG 501
                           |||||||||||||||||||||
18657R-1.in silico     481 CACCGATCACGGGCTCAGTTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.