National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18610R-3 
 Symbol CG30122  Full Name CG30122 
 CG No CG30122  Old CG No CG18610 
 Synonyms LD11002, CG18610, CG5477, CG30122 
 Accession No (Link to NCBI) NM_137510.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTTCAAGCGAATTGCGGTCGT 
 Primer Seq. 3'
aatctagaggtaccGCACCCAATTTTGCTGGCCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTTCAAGCGA ATTGCGGTTC GTTTGCATAC CCAGCGAAGA TGAATTGAAA CGTCGCATCG 
0061 CCGAAAAAGA GGAAAAGGGA AATGCTTTTA CAGTTAAAGA ATCAACAATT AATAATTTAC 
0121 GAGCCAACTT CACACTTCCC TCGCTGGAGT TTGGCTGGTT CGATGATATA AACTACACGG 
0181 AGCTGACTGG TGACGAGGCC AAGAGCGAGG TCAAGAAGTA CAACGAGAAG GGCAAAAAGG 
0241 CCATTGACGC GGAGAGGTCG CGTGACAAGA GATCCCGAGG AAGTCGCGAC AACTATCGTC 
0301 GTGATGACCG GAACCGGAAT CGATACAATG ATGACCGACG TCGTGATTAT GGCGGCCAGC 
0361 GGCACGAAAG TCGTTGGAGC GACTCCCGCA GGGGAGGCGG CGGTGGCGGT TACTCCAGCA 
0421 ATAGTGGTGG AGGCGGCAGT CGTGGCTACG ACAATCGCCG CAACTACAAC AGCGGTAGCG 
0481 GTGGCCAGCA AAAATTGGGT GC 
 in silico PCR Fragment
0001 CTTCAAGCGA ATTGCGG-TC GTTTGCATAC CCAGCGAAGA TGAATTGAAA CGTCGCATCG 
0061 CCGAAAAAGA GGAAAAGGGA AATGCTTTTA CAGTTAAAGA ATCAACAATT AATAATTTAC 
0121 GAGCCAACTT CACACTTCCC TCGCTGGAGT TTGGCTGGTT CGATGATATA AACTACACGG 
0181 AGCTGACTGG TGACGAGGCC AAGAGCGAGG TCAAGAAGTA CAACGAGAAG GGCAAAAAGG 
0241 CCATTGACGC GGAGAGGTCG CGTGACAAGA GATCCCGAGG AAGTCGCGAC AACTATCGTC 
0301 GTGATGACCG GAACCGGAAT CGATACAATG ATGACCGACG TCGTGATTAT GGCGGCCAGC 
0361 GGCACGAAAG TCGTTGGAGC GACTCCCGCA GGGGAGGCGG CGGTGGCGGT TACTCCAGCA 
0421 ATAGTGGTGG AGGCGGCAGT CGTGGCTACG ACAATCGCCG CAACTACAAC AGCGGTAGCG 
0481 GTGGCCAGC- AAAATTGGGT GC 
 Assemble Data

18610R-3.IR_full       1   CTTCAAGCGAATTGCGGTTCGTTTGCATACCCAGCGAAGATGAATTGAAACGTCGCATCG 60
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
18610R-3.in silico     1   CTTCAAGCGAATTGCGG-TCGTTTGCATACCCAGCGAAGATGAATTGAAACGTCGCATCG 60


18610R-3.IR_full       61  CCGAAAAAGAGGAAAAGGGAAATGCTTTTACAGTTAAAGAATCAACAATTAATAATTTAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18610R-3.in silico     61  CCGAAAAAGAGGAAAAGGGAAATGCTTTTACAGTTAAAGAATCAACAATTAATAATTTAC 120


18610R-3.IR_full       121 GAGCCAACTTCACACTTCCCTCGCTGGAGTTTGGCTGGTTCGATGATATAAACTACACGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18610R-3.in silico     121 GAGCCAACTTCACACTTCCCTCGCTGGAGTTTGGCTGGTTCGATGATATAAACTACACGG 180


18610R-3.IR_full       181 AGCTGACTGGTGACGAGGCCAAGAGCGAGGTCAAGAAGTACAACGAGAAGGGCAAAAAGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18610R-3.in silico     181 AGCTGACTGGTGACGAGGCCAAGAGCGAGGTCAAGAAGTACAACGAGAAGGGCAAAAAGG 240


18610R-3.IR_full       241 CCATTGACGCGGAGAGGTCGCGTGACAAGAGATCCCGAGGAAGTCGCGACAACTATCGTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18610R-3.in silico     241 CCATTGACGCGGAGAGGTCGCGTGACAAGAGATCCCGAGGAAGTCGCGACAACTATCGTC 300


18610R-3.IR_full       301 GTGATGACCGGAACCGGAATCGATACAATGATGACCGACGTCGTGATTATGGCGGCCAGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18610R-3.in silico     301 GTGATGACCGGAACCGGAATCGATACAATGATGACCGACGTCGTGATTATGGCGGCCAGC 360


18610R-3.IR_full       361 GGCACGAAAGTCGTTGGAGCGACTCCCGCAGGGGAGGCGGCGGTGGCGGTTACTCCAGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18610R-3.in silico     361 GGCACGAAAGTCGTTGGAGCGACTCCCGCAGGGGAGGCGGCGGTGGCGGTTACTCCAGCA 420


18610R-3.IR_full       421 ATAGTGGTGGAGGCGGCAGTCGTGGCTACGACAATCGCCGCAACTACAACAGCGGTAGCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18610R-3.in silico     421 ATAGTGGTGGAGGCGGCAGTCGTGGCTACGACAATCGCCGCAACTACAACAGCGGTAGCG 480


18610R-3.IR_full       481 GTGGCCAGCAAAAATTGGGTGC 502
                           ||||||||| ||||||||||||
18610R-3.in silico     481 GTGGCCAGC-AAAATTGGGTGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  18  NM_137510.2  CG30122-RB (CG30122), mRNA 
0.2   11  50  NM_167493.1  CG3606-RA, transcript variant A (caz), mRNA 
0.2   11  50  NM_078641.2  CG3606-RB, transcript variant B (caz), mRNA 
0   NM_206382.1  CG5151-RB, transcript variant B (CG5151), mRNA 
0   NM_140587.1  CG5151-RA, transcript variant A (CG5151), mRNA 
0   28  NM_135595.2  CG17108-RA (CG17108), mRNA 
0   NM_135607.2  CG6495-RA (CG6495), mRNA 
0   19  NM_057695.3  CG4038-RA (CG4038), mRNA 
0   NM_079706.2  CG3412-RA (slmb), mRNA 
0   NM_001042873.1  CG31651-RB, transcript variant B (pgant5), mRNA 
0   NM_135062.3  CG31651-RA, transcript variant A (pgant5), mRNA 
0   13  NM_142942.3  CG31140-RA, transcript variant A (CG31140), mRNA 
0   12  NM_206553.1  CG31140-RB, transcript variant B (CG31140), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
0   NM_166413.2  CG10052-RA (Rx), mRNA 
0   NM_143717.1  CG10840-RB (eIF5B), mRNA 
0   NM_142382.1  CG14326-RA (CG14326), mRNA 
0   NM_136761.2  CG7614-RA (Mat1), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   19  NM_141642.1  CG9373-RA (CG9373), mRNA 
0   16  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   NM_137767.2  CG4386-RA (CG4386), mRNA 
0   10  NM_132953.1  CG13001-RA (CG13001), mRNA 
0   NM_079962.3  CG18042-RA (lmg), mRNA 
0   NM_206095.1  CG13214-RB, transcript variant B (CG13214), mRNA 
0   NM_165832.1  CG30026-RA (CG30026), mRNA 
0   11  NM_168102.1  CG32239-RA (Gef64C), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_170646.3  CG31349-RE, transcript variant E (pyd), mRNA 
0   NM_132386.2  CG2961-RA (Ipod), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.