National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18600R-1 
 Symbol CG18600  Full Name CG18600 
 CG No CG18600  Old CG No CG18600 
 Synonyms CK01205, BEST:CK01205, CG18600 
 Accession No (Link to NCBI) NM_142451.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees female semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGAATGGATCTCTTTTGGGCG 
 Primer Seq. 3'
aatctagaggtaccCACTTTGGTTGCCTCCTTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGAAtGGATC TCTTTTGGGC GACGCAGATT TCAGCATGGT AGAGAGCACC GTGGATGGCA 
0061 AAAAGCATGC CTTAGTATAC GCGGGTGACC AGGTGTACAC GGGCGAGGTG AAGGATAGCG 
0121 AGGAAGTCGA TACCTACATT TTCATAAGGA ACAAATTAAC CAACAAAGTT AAAGTCGTGC 
0181 CAGTGCAAGA GGCATTGATG TACAATCACG TTTACAAGAA ACTGGAGCGA CAGAAGAGAA 
0241 CGGGTCCCAC GATGAGCCGG GAGCACGCCA ACAAGAAGCT GCTCAAGGAG TTTGGAGGGC 
0301 GCANAGGCAT CCCGCTTCGT GGACAACCGC GAACAGATGA TGGTCAACGT GGAGGTGATG 
0361 CGTCAGGATC TGGACGAAAC GGTGAATTCG AGCATGCTCA ACGAAGACGA AGAGGACGGC 
0421 ACCCTGGGTG ATGTGAGCAT CAACAATGAG GAGTACCTGG CCAGCATTGT GCCCCGAGTT 
0481 CAACAAGGAG GCAACCAAAG TG 
 in silico PCR Fragment
0001 AGAATGGATC TCTTTTGGGC GACGCAGATT TCAGCATGGT AGAGAGCACC GTAGATGGCA 
0061 AAAAGCATGC CTTAGTATAC GCGGGTGACC AGGTGTACAC GGGCGAGGTG AAGGATAGCG 
0121 AGGAAGTCGA TACCTACATT TTCATAAGGA ACAAATTAAC CAACAAAGTT AAAGTCGTGC 
0181 CAGTGCAAGA GGCATTGATG TACAATCACG TTTACAAGAA ACTGGAGCGA CAGAAGAGAA 
0241 CGGGTCCCAC GATGAGCCGG GAGCACGCCA ACAAGAAGCT GCTCAAGGAG TTTGGAGGGC 
0301 GCA-AGGCAT CCCGCTTCGT GGACAACCGC GAACAGATGA TGGTCAACGT GGAGGTGATG 
0361 CGTCAGGATC TGGACGAAAC GGTGAATTCG AGCATGCTCA ACGAAGACGA AGAGGACGGC 
0421 ACCCTGGGTG ATGTGAGCAT CAACAATGAG GAGTACCTGG CCAGCATTGT G-CCCGAGTT 
0481 CAACAAGGAG GCAACCAAAG TG 
 Assemble Data

18600R-1.IR_full       1   AGAATGGATCTCTTTTGGGCGACGCAGATTTCAGCATGGTAGAGAGCACCGTGGATGGCA 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
18600R-1.in silico     1   AGAATGGATCTCTTTTGGGCGACGCAGATTTCAGCATGGTAGAGAGCACCGTAGATGGCA 60


18600R-1.IR_full       61  AAAAGCATGCCTTAGTATACGCGGGTGACCAGGTGTACACGGGCGAGGTGAAGGATAGCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18600R-1.in silico     61  AAAAGCATGCCTTAGTATACGCGGGTGACCAGGTGTACACGGGCGAGGTGAAGGATAGCG 120


18600R-1.IR_full       121 AGGAAGTCGATACCTACATTTTCATAAGGAACAAATTAACCAACAAAGTTAAAGTCGTGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18600R-1.in silico     121 AGGAAGTCGATACCTACATTTTCATAAGGAACAAATTAACCAACAAAGTTAAAGTCGTGC 180


18600R-1.IR_full       181 CAGTGCAAGAGGCATTGATGTACAATCACGTTTACAAGAAACTGGAGCGACAGAAGAGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18600R-1.in silico     181 CAGTGCAAGAGGCATTGATGTACAATCACGTTTACAAGAAACTGGAGCGACAGAAGAGAA 240


18600R-1.IR_full       241 CGGGTCCCACGATGAGCCGGGAGCACGCCAACAAGAAGCTGCTCAAGGAGTTTGGAGGGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18600R-1.in silico     241 CGGGTCCCACGATGAGCCGGGAGCACGCCAACAAGAAGCTGCTCAAGGAGTTTGGAGGGC 300


18600R-1.IR_full       301 GCANAGGCATCCCGCTTCGTGGACAACCGCGAACAGATGATGGTCAACGTGGAGGTGATG 360
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18600R-1.in silico     301 GCA-AGGCATCCCGCTTCGTGGACAACCGCGAACAGATGATGGTCAACGTGGAGGTGATG 360


18600R-1.IR_full       361 CGTCAGGATCTGGACGAAACGGTGAATTCGAGCATGCTCAACGAAGACGAAGAGGACGGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18600R-1.in silico     361 CGTCAGGATCTGGACGAAACGGTGAATTCGAGCATGCTCAACGAAGACGAAGAGGACGGC 420


18600R-1.IR_full       421 ACCCTGGGTGATGTGAGCATCAACAATGAGGAGTACCTGGCCAGCATTGTGCCCCGAGTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
18600R-1.in silico     421 ACCCTGGGTGATGTGAGCATCAACAATGAGGAGTACCTGGCCAGCATTGTG-CCCGAGTT 480


18600R-1.IR_full       481 CAACAAGGAGGCAACCAAAGTG 502
                           ||||||||||||||||||||||
18600R-1.in silico     481 CAACAAGGAGGCAACCAAAGTG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142451.2  CG18600-RA (CG18600), mRNA 
0   NM_176750.1  CG5613-RB, transcript variant B (CG5613), mRNA 
0   NM_132987.1  CG5613-RA, transcript variant A (CG5613), mRNA 
0   NM_079395.2  CG9695-RA (Dab), mRNA 
0   NM_136852.1  CG13197-RA (CG13197), mRNA 
0   NM_136042.1  CG15160-RA (CG15160), mRNA 
0   NM_079306.2  CG5940-RA, transcript variant A (CycA), mRNA 
0   NM_205870.2  CG2380-RB (NfI), mRNA 
0   NM_138244.2  CG9129-RA (CG9129), mRNA 
0   NM_135329.1  CG12560-RA (CG12560), mRNA 
0   NM_168144.1  CG32409-RA (CG32409), mRNA 
0   NM_136729.2  CG12909-RA (CG12909), mRNA 
0   11  NM_167399.4  CG12047-RB, transcript variant B (mud), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   NM_165842.1  CG10897-RC, transcript variant C (tou), mRNA 
0   NM_165844.1  CG10897-RB, transcript variant B (tou), mRNA 
0   NM_165843.1  CG10897-RD, transcript variant D (tou), mRNA 
0   NM_167387.1  CG32611-RB (CG32611), mRNA 
0   NM_136086.4  CG31793-RA (CG31793), mRNA 
0   NM_141892.2  CG14735-RA (CG14735), mRNA 
0   NM_135461.2  CG4364-RA (CG4364), mRNA 
0   NM_143279.2  CG6070-RA (CG6070), mRNA 
0   NM_136472.3  CG1399-RB, transcript variant B (CG1399), mRNA 
0   NM_165549.2  CG1399-RA, transcript variant A (CG1399), mRNA 
0   NM_135298.1  CG7211-RA (CG7211), mRNA 
0   NM_078532.1  CG1478-RA (Cp36), mRNA 
0   NM_142682.1  CG3421-RA (RhoGAP93B), mRNA 
0   NM_134665.2  CG3345-RA (CG3345), mRNA 
0   NM_132420.2  CG32676-RA (CG32676), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.