National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1859R-3 
 Symbol Spn43Ad  Full Name Spn43Ad 
 CG No CG1859  Old CG No CG1859 
 Synonyms CG1859, Spn43Ad 
 Accession No (Link to NCBI) NM_136417.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GATCCACTGGAGACTTCTTTCCGCCCTACTTGTGGGCCTGGCTATAGCTTTAACGCTTCC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGTCGACGGGGAGCTCTTGGCCAGATCGCCGGCCAGCGTCTCGAGTAACCGCTTTGGCCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACGCCTAACTACTAAGTTGGGACTAACTCAACCAGATGCAAATGTGGTGGTTTCCCCCTT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTTATACAGGCGGCGCTCAGCCTGCTGTATGCGGAAAGTTCTTCGGAGTACGGTAGCCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACTCCGCCAGGCTCTGGAGCTGACCCACGCCAGTCACCCGAAGCTTGCGGTGCAGGACTT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGAGACCCTTTTGACGGACCTCAAGCAGTCGGCTGCCATTGGCTGTCGCTTGCGGTTGCT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAGTGACCTCTACGCACAGCAGCGCTTCACCTTCAACTTCCGCAATGAATTCGAGACCTT 420

                          |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     421 GGCCGCCCGAATGGGCGTCGGC-TGCCACCGCTTGTCGTGGGAAAGTGCGTCGAACGCGG 480

1859R-3.IR_full       481 CCCAGGATATCAACTACGCCT 501
                          ||||||||||||||||||||| silico     481 CCCAGGATATCAACTACGCCT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136417.2  CG1859-RA (Spn43Ad), mRNA 
0   11  NM_134550.1  CG1695-RA, transcript variant A (CG1695), mRNA 
0   11  NM_167705.1  CG1695-RB, transcript variant B (CG1695), mRNA 
0   NM_142456.1  CG15803-RA (CG15803), mRNA 
0   NM_139482.1  CG14950-RA (CG14950), mRNA 
0   NM_205928.1  CG8086-RD, transcript variant D (CG8086), mRNA 
0   NM_170611.1  CG8086-RA, transcript variant A (CG8086), mRNA 
0   NM_057879.3  CG8086-RB, transcript variant B (CG8086), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_142098.1  CG8538-RA (CG8538), mRNA 
0   NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
0   NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 
0   NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   NM_057420.3  CG7875-RA (trp), mRNA 
0   NM_137613.2  CG11099-RA (CG11099), mRNA 
0   NM_165587.1  CG8712-RB, transcript variant B (CG8712), mRNA 
0   NM_136506.2  CG8712-RA, transcript variant A (CG8712), mRNA 
0   NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   NM_140052.1  CG3967-RA, transcript variant A (CG3967), mRNA 
0   NM_170631.1  CG3967-RE, transcript variant E (CG3967), mRNA 
0   NM_170630.1  CG3967-RD, transcript variant D (CG3967), mRNA 
0   NM_140053.2  CG3967-RC, transcript variant C (CG3967), mRNA 
0   NM_140465.2  CG9311-RA (CG9311), mRNA 
0   NM_135691.1  CG6734-RA (CG6734), mRNA 
0   NM_130487.2  CG18273-RA (CG18273), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.