National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1859R-1 
 Symbol Spn43Ad  Full Name Spn43Ad 
 CG No CG1859  Old CG No CG1859 
 Synonyms CG1859, Spn43Ad 
 Accession No (Link to NCBI) NM_136417.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCCACTGGAGACTTCTTTC 
 Primer Seq. 3'
aatctagaggtaccAGGCGTAGTTGATATCCTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATCCACTGG AGACTTCTTT CCGCCCTACT TGTGGGCCTG GCTATAGCTT TAACGCTTCC 
0061 AGTCGACGGG GAGCTCTTGG CCAGATCGCC GGCCAGCGTC TCGAGTAACC GCTTTGGCCT 
0121 ACGCCTAACT ACTAAGTTGG GACTAACTCA ACCAGATGCA AATGTGGTGG TTTCCCCCTT 
0181 GCTTATACAG GCGGCGCTCA GCCTGCTGTA TGCGGAAAGT TCTTCGGAGT ACGGTAGCCA 
0241 ACTCCGCCAG GCTCTGGAGC TGACCCACGC CAGTCACCCG AAGCTTGCGG TGCAGGACTT 
0301 CGAGACCCTT TTGACGGACC TCAAGCAGTC GGCTGCCATT GGCTGTCGCT TGCGGTTGCT 
0361 GAGTGACCTC TACGCACAGC AGCGCTTCAC CTTCAACTTC CGCAATGAAT TCGAGACCTT 
0421 GGCCGCCCGA ATGGGCGTCG GCTTGCCACC GCTTGTCGTG GGAAAGTGCG TCGAACGCGG 
0481 CCCAGGATAT CAACTACGCC T 
 in silico PCR Fragment
0001 GATCCACTGG AGACTTCTTT CCGCCCTACT TGTGGGCCTG GCTATAGCTT TAACGCTTCC 
0061 AGTCGACGGG GAGCTCTTGG CCAGATCGCC GGCCAGCGTC TCGAGTAACC GCTTTGGCCT 
0121 ACGCCTAACT ACTAAGTTGG GACTAACTCA ACCAGATGCA AATGTGGTGG TTTCCCCCTT 
0181 GCTTATACAG GCGGCGCTCA GCCTGCTGTA TGCGGAAAGT TCTTCGGAGT ACGGTAGCCA 
0241 ACTCCGCCAG GCTCTGGAGC TGACCCACGC CAGTCACCCG AAGCTTGCGG TGCAGGACTT 
0301 CGAGACCCTT TTGACGGACC TCAAGCAGTC GGCTGCCATT GGCTGTCGCT TGCGGTTGCT 
0361 GAGTGACCTC TACGCACAGC AGCGCTTCAC CTTCAACTTC CGCAATGAAT TCGAGACCTT 
0421 GGCCGCCCGA ATGGGCGTCG GC-TGCCACC GCTTGTCGTG GGAAAGTGCG TCGAACGCGG 
0481 CCCAGGATAT CAACTACGCC T 
 Assemble Data

1859R-1.IR_full       1   GATCCACTGGAGACTTCTTTCCGCCCTACTTGTGGGCCTGGCTATAGCTTTAACGCTTCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1859R-1.in silico     1   GATCCACTGGAGACTTCTTTCCGCCCTACTTGTGGGCCTGGCTATAGCTTTAACGCTTCC 60


1859R-1.IR_full       61  AGTCGACGGGGAGCTCTTGGCCAGATCGCCGGCCAGCGTCTCGAGTAACCGCTTTGGCCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1859R-1.in silico     61  AGTCGACGGGGAGCTCTTGGCCAGATCGCCGGCCAGCGTCTCGAGTAACCGCTTTGGCCT 120


1859R-1.IR_full       121 ACGCCTAACTACTAAGTTGGGACTAACTCAACCAGATGCAAATGTGGTGGTTTCCCCCTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1859R-1.in silico     121 ACGCCTAACTACTAAGTTGGGACTAACTCAACCAGATGCAAATGTGGTGGTTTCCCCCTT 180


1859R-1.IR_full       181 GCTTATACAGGCGGCGCTCAGCCTGCTGTATGCGGAAAGTTCTTCGGAGTACGGTAGCCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1859R-1.in silico     181 GCTTATACAGGCGGCGCTCAGCCTGCTGTATGCGGAAAGTTCTTCGGAGTACGGTAGCCA 240


1859R-1.IR_full       241 ACTCCGCCAGGCTCTGGAGCTGACCCACGCCAGTCACCCGAAGCTTGCGGTGCAGGACTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1859R-1.in silico     241 ACTCCGCCAGGCTCTGGAGCTGACCCACGCCAGTCACCCGAAGCTTGCGGTGCAGGACTT 300


1859R-1.IR_full       301 CGAGACCCTTTTGACGGACCTCAAGCAGTCGGCTGCCATTGGCTGTCGCTTGCGGTTGCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1859R-1.in silico     301 CGAGACCCTTTTGACGGACCTCAAGCAGTCGGCTGCCATTGGCTGTCGCTTGCGGTTGCT 360


1859R-1.IR_full       361 GAGTGACCTCTACGCACAGCAGCGCTTCACCTTCAACTTCCGCAATGAATTCGAGACCTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1859R-1.in silico     361 GAGTGACCTCTACGCACAGCAGCGCTTCACCTTCAACTTCCGCAATGAATTCGAGACCTT 420


1859R-1.IR_full       421 GGCCGCCCGAATGGGCGTCGGCTTGCCACCGCTTGTCGTGGGAAAGTGCGTCGAACGCGG 480
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
1859R-1.in silico     421 GGCCGCCCGAATGGGCGTCGGC-TGCCACCGCTTGTCGTGGGAAAGTGCGTCGAACGCGG 480


1859R-1.IR_full       481 CCCAGGATATCAACTACGCCT 501
                          |||||||||||||||||||||
1859R-1.in silico     481 CCCAGGATATCAACTACGCCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136417.2  CG1859-RA (Spn43Ad), mRNA 
0   11  NM_134550.1  CG1695-RA, transcript variant A (CG1695), mRNA 
0   11  NM_167705.1  CG1695-RB, transcript variant B (CG1695), mRNA 
0   NM_142456.1  CG15803-RA (CG15803), mRNA 
0   NM_139482.1  CG14950-RA (CG14950), mRNA 
0   NM_205928.1  CG8086-RD, transcript variant D (CG8086), mRNA 
0   NM_170611.1  CG8086-RA, transcript variant A (CG8086), mRNA 
0   NM_057879.3  CG8086-RB, transcript variant B (CG8086), mRNA 
0   NM_079176.1  CG12008-RA, transcript variant A (kst), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_206265.1  CG12008-RC, transcript variant C (kst), mRNA 
0   NM_142098.1  CG8538-RA (CG8538), mRNA 
0   NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
0   NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 
0   NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   NM_057420.3  CG7875-RA (trp), mRNA 
0   NM_137613.2  CG11099-RA (CG11099), mRNA 
0   NM_165587.1  CG8712-RB, transcript variant B (CG8712), mRNA 
0   NM_136506.2  CG8712-RA, transcript variant A (CG8712), mRNA 
0   NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   NM_140052.1  CG3967-RA, transcript variant A (CG3967), mRNA 
0   NM_170631.1  CG3967-RE, transcript variant E (CG3967), mRNA 
0   NM_170630.1  CG3967-RD, transcript variant D (CG3967), mRNA 
0   NM_140053.2  CG3967-RC, transcript variant C (CG3967), mRNA 
0   NM_140465.2  CG9311-RA (CG9311), mRNA 
0   NM_135691.1  CG6734-RA (CG6734), mRNA 
0   NM_130487.2  CG18273-RA (CG18273), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.