National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1857R-2 
 Symbol nec  Full Name necrotic 
 CG No CG1857  Old CG No CG1857 
 Synonyms Spn43Ac, CG1857, SER3, Ser3, anon-WO0118057.3, nec, Nec 
 Accession No (Link to NCBI) NM_080112.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTAACCGTCCATCTTCTGGCT 
 Primer Seq. 3'
aatctagaggtaccTTGTACTTGATCACGCTCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTAACCGTCC ATCTTCTGGC TGCTCAGACC TTCGCCCAGG AGCTCATCGC TTGGCAACGG 
0061 CAACAACAAC AGCAGCAACA GCAGCAACTG CAGCTACAGC AGCAAANCTG CTGcTGCAGC 
0121 AGCAACAACA CCAACGTAAC CCAAGACCGG AGCTGGGCCT CCGTTCCCTG CCCGGAAACC 
0181 CGTGGACCCA GAACAATCAG GAAGCCATAA GCGATGTGGT GGCGGTGGAC CTAACCAAAC 
0241 GTGAGCCGGT CACTCCGCCA CCCAATCGCC CGCCGCCCGT CTTCAGCTAC ATGGACCGCT 
0301 TCAGCTCCGA GCTCTTCAAG GAGATCATTA AGTCGCAAAG TCAGCAGAAC GTGGTGTTCT 
0361 CGCCCTTCTC CGTCCACGCG CTGCTGGCCC TGATCTACGG GGCCTCGGAC GGAAAAACGT 
0421 TCCGGGAACT GCAGAAGGCC GGAGAGTTCA GCAAGAACGC CATGGCCGTG GCCCAGGACT 
0481 TCGAGAGCGT GATCAAGTAC AA 
 in silico PCR Fragment
0001 CTAACCGTCC ATCTTCTGGC TGCTCAGACC TTCGCCCAGG AGCTCATCGC TTGGCAACGG 
0061 CAACAACAAC AGCAGCAACA GCAGCAACTG CAGCTACAGC AGCAA--CTG CTGCTGCAGC 
0121 AGCAACAACA CCAACGTAAC CCAAGACCGG AGCTGGGCCT CCGTTCCCTG CCCGGAAACC 
0181 CGTGGACCCA GAACAATCAG GAAGCCATAA GCGATGTGGT GGCGGTGGAC CTAACCAAAC 
0241 GTGAGCCGGT CACTCCGCCA CCCAATCGCC CGCCGCCCGT CTTCAGCTAC ATGGACCGCT 
0301 TCAGCTCCGA GCTCTTCAAG GAGATCATTA AGTCGCAAAG TCAGCAGAAC GTGGTGTTCT 
0361 CGCCCTTCTC CGTCCACGCG CTGCTGGCCC TGATCTACGG GGCCTCGGAC GGAAAAACGT 
0421 TCCGGGAACT GCAGAAGGCC GGAGAGTTCA GCAAGAACGC CATGGCCGTG GCCCAGGACT 
0481 TCGAGAGCGT GATCAAGTAC AA 
 Assemble Data

1857R-2.IR_full        1   TAACCGTCCATCTTCTGGCTGCTCAGACCTTCGCCCAGGAGCTCATCGCTTGGCAACGG 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1857R-2.in silico      1   TAACCGTCCATCTTCTGGCTGCTCAGACCTTCGCCCAGGAGCTCATCGCTTGGCAACGG 59


1857R-2.IR_full       61  CAACAACAACAGCAGCAACAGCAGCAACTGCAGCTACAGCAGCAAANCTGCTGCTGCAGC 119
                          |||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||
1857R-2.in silico     61  CAACAACAACAGCAGCAACAGCAGCAACTGCAGCTACAGCAGCAA--CTGCTGCTGCAGC 119


1857R-2.IR_full       121 AGCAACAACACCAACGTAACCCAAGACCGGAGCTGGGCCTCCGTTCCCTGCCCGGAAACC 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1857R-2.in silico     121 AGCAACAACACCAACGTAACCCAAGACCGGAGCTGGGCCTCCGTTCCCTGCCCGGAAACC 179


1857R-2.IR_full       181 CGTGGACCCAGAACAATCAGGAAGCCATAAGCGATGTGGTGGCGGTGGACCTAACCAAAC 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1857R-2.in silico     181 CGTGGACCCAGAACAATCAGGAAGCCATAAGCGATGTGGTGGCGGTGGACCTAACCAAAC 239


1857R-2.IR_full       241 GTGAGCCGGTCACTCCGCCACCCAATCGCCCGCCGCCCGTCTTCAGCTACATGGACCGCT 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1857R-2.in silico     241 GTGAGCCGGTCACTCCGCCACCCAATCGCCCGCCGCCCGTCTTCAGCTACATGGACCGCT 299


1857R-2.IR_full       301 TCAGCTCCGAGCTCTTCAAGGAGATCATTAAGTCGCAAAGTCAGCAGAACGTGGTGTTCT 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1857R-2.in silico     301 TCAGCTCCGAGCTCTTCAAGGAGATCATTAAGTCGCAAAGTCAGCAGAACGTGGTGTTCT 359


1857R-2.IR_full       361 CGCCCTTCTCCGTCCACGCGCTGCTGGCCCTGATCTACGGGGCCTCGGACGGAAAAACGT 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1857R-2.in silico     361 CGCCCTTCTCCGTCCACGCGCTGCTGGCCCTGATCTACGGGGCCTCGGACGGAAAAACGT 419


1857R-2.IR_full       421 TCCGGGAACTGCAGAAGGCCGGAGAGTTCAGCAAGAACGCCATGGCCGTGGCCCAGGACT 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1857R-2.in silico     421 TCCGGGAACTGCAGAAGGCCGGAGAGTTCAGCAAGAACGCCATGGCCGTGGCCCAGGACT 479


1857R-2.IR_full       481 TCGAGAGCGTGATCAAGTACAA 501
                          ||||||||||||||||||||||
1857R-2.in silico     481 TCGAGAGCGTGATCAAGTACAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  60  69  NM_080112.1  CG1857-RA (nec), mRNA 
4.56   22  59  125  137  NM_167617.1  CG32548-RB, transcript variant B (CG32548), mRNA 
4.56   22  59  125  131  NM_133065.2  CG32548-RC, transcript variant C (CG32548), mRNA 
3.52   17  39  96  172  NM_137027.1  CG4744-RA (CG4744), mRNA 
3.11   15  173  784  2358  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
3.11   15  173  784  2358  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
3.11   15  173  784  2358  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
2.48   12  30  195  660  NM_132288.1  CG15365-RA (CG15365), mRNA 
2.07   10  32  152  487  NM_001014576.1  CG7391-RD, transcript variant D (Clk), mRNA 
2.07   10  32  152  487  NM_001014575.1  CG7391-RE, transcript variant E (Clk), mRNA 
2.07   10  32  152  487  NM_001014574.1  CG7391-RF, transcript variant F (Clk), mRNA 
2.07   10  32  152  487  NM_079240.2  CG7391-RA, transcript variant A (Clk), mRNA 
2.07   10  32  152  487  NM_206299.1  CG7391-RC, transcript variant C (Clk), mRNA 
2.07   10  32  152  487  NM_170628.1  CG7391-RB, transcript variant B (Clk), mRNA 
2.07   10  23  63  207  NM_078545.2  CG12653-RA (btd), mRNA 
1.86   19  187  477  NM_079845.2  CG7951-RA (sima), mRNA 
1.65   32  124  328  NM_142209.2  CG5166-RA, transcript variant A (Atx2), mRNA 
1.65   32  124  328  NM_169657.1  CG5166-RB, transcript variant B (Atx2), mRNA 
1.65   32  124  328  NM_169658.2  CG5166-RC, transcript variant C (Atx2), mRNA 
1.45   57  315  927  NM_135077.2  CG14023-RA (CG14023), mRNA 
1.45   46  238  873  NM_001038734.1  CG16902-RC (Hr4), mRNA 
1.45   40  108  434  NM_165035.1  CG6043-RB, transcript variant B (CG6043), mRNA 
1.45   40  108  434  NM_165037.1  CG6043-RC, transcript variant C (CG6043), mRNA 
1.45   40  108  434  NM_165034.1  CG6043-RA, transcript variant A (CG6043), mRNA 
1.45   40  108  432  NM_135785.1  CG6043-RD, transcript variant D (CG6043), mRNA 
1.45   36  163  429  NM_206357.2  CG33261-RD, transcript variant D (Trl), mRNA 
1.45   27  117  326  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
1.45   27  117  326  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
1.45   26  126  369  NM_206356.2  CG33261-RB, transcript variant B (Trl), mRNA 
1.45   28  85  NM_001038924.1  CG33261-RG, transcript variant G (Trl), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
 
Dcompartment   Penetrance
++     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.