National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1857R-1 
 Symbol nec  Full Name necrotic 
 CG No CG1857  Old CG No CG1857 
 Synonyms Spn43Ac, CG1857, SER3, Ser3, anon-WO0118057.3, nec, Nec 
 Accession No (Link to NCBI) NM_080112.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   TAACCGTCCATCTTCTGGCTGCTCAGACCTTCGCCCAGGAGCTCATCGCTTGGCAACGG 59

                          |||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||| silico     61  CAACAACAACAGCAGCAACAGCAGCAACTGCAGCTACAGCAGCAA--CTGCTGCTGCAGC 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGCAACAACACCAACGTAACCCAAGACCGGAGCTGGGCCTCCGTTCCCTGCCCGGAAACC 179

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGTGGACCCAGAACAATCAGGAAGCCATAAGCGATGTGGTGGCGGTGGACCTAACCAAAC 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTGAGCCGGTCACTCCGCCACCCAATCGCCCGCCGCCCGTCTTCAGCTACATGGACCGCT 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCAGCTCCGAGCTCTTCAAGGAGATCATTAAGTCGCAAAGTCAGCAGAACGTGGTGTTCT 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGCCCTTCTCCGTCCACGCGCTGCTGGCCCTGATCTACGGGGCCTCGGACGGAAAAACGT 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCCGGGAACTGCAGAAGGCCGGAGAGTTCAGCAAGAACGCCATGGCCGTGGCCCAGGACT 479

1857R-1.IR_full       481 TCGAGAGCGTGATCAAGTACAA 501
                          |||||||||||||||||||||| silico     481 TCGAGAGCGTGATCAAGTACAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  60  69  NM_080112.1  CG1857-RA (nec), mRNA 
4.56   22  59  125  137  NM_167617.1  CG32548-RB, transcript variant B (CG32548), mRNA 
4.56   22  59  125  131  NM_133065.2  CG32548-RC, transcript variant C (CG32548), mRNA 
3.52   17  39  96  172  NM_137027.1  CG4744-RA (CG4744), mRNA 
3.11   15  173  784  2358  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
3.11   15  173  784  2358  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
3.11   15  173  784  2358  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
2.48   12  30  195  660  NM_132288.1  CG15365-RA (CG15365), mRNA 
2.07   10  32  152  487  NM_001014576.1  CG7391-RD, transcript variant D (Clk), mRNA 
2.07   10  32  152  487  NM_001014575.1  CG7391-RE, transcript variant E (Clk), mRNA 
2.07   10  32  152  487  NM_001014574.1  CG7391-RF, transcript variant F (Clk), mRNA 
2.07   10  32  152  487  NM_079240.2  CG7391-RA, transcript variant A (Clk), mRNA 
2.07   10  32  152  487  NM_206299.1  CG7391-RC, transcript variant C (Clk), mRNA 
2.07   10  32  152  487  NM_170628.1  CG7391-RB, transcript variant B (Clk), mRNA 
2.07   10  23  63  207  NM_078545.2  CG12653-RA (btd), mRNA 
1.86   19  187  477  NM_079845.2  CG7951-RA (sima), mRNA 
1.65   32  124  328  NM_142209.2  CG5166-RA, transcript variant A (Atx2), mRNA 
1.65   32  124  328  NM_169657.1  CG5166-RB, transcript variant B (Atx2), mRNA 
1.65   32  124  328  NM_169658.2  CG5166-RC, transcript variant C (Atx2), mRNA 
1.45   57  315  927  NM_135077.2  CG14023-RA (CG14023), mRNA 
1.45   46  238  873  NM_001038734.1  CG16902-RC (Hr4), mRNA 
1.45   40  108  434  NM_165035.1  CG6043-RB, transcript variant B (CG6043), mRNA 
1.45   40  108  434  NM_165037.1  CG6043-RC, transcript variant C (CG6043), mRNA 
1.45   40  108  434  NM_165034.1  CG6043-RA, transcript variant A (CG6043), mRNA 
1.45   40  108  432  NM_135785.1  CG6043-RD, transcript variant D (CG6043), mRNA 
1.45   36  163  429  NM_206357.2  CG33261-RD, transcript variant D (Trl), mRNA 
1.45   27  117  326  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
1.45   27  117  326  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
1.45   26  126  369  NM_206356.2  CG33261-RB, transcript variant B (Trl), mRNA 
1.45   28  85  NM_001038924.1  CG33261-RG, transcript variant G (Trl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.