National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18559R-2 
 Symbol Cyp309a2  Full Name Cyp309a2 
 CG No CG18559  Old CG No CG18559 
 Synonyms 309a2, CG18559, Cyp309a2 
 Accession No (Link to NCBI) NM_134845.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     1   GGCACCACAAGTACTGGCGCAAGCGGGGATTGGTCACGGCGCGGCCCCTGACCCTGCTGG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCACGTATCCGGGCCTGCTCACCCGCAAGAGCAATCTGGTCTTCGACGTGCAGAAGATCT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATGATAAATACAAGGGGAAGCACCGAGCTGTTGGCGTCTTTGTGACCCGACAGCCGCAGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCCTGGTCCTCGATCCGGAGCTGGCCCACGAAGTGCTGGTGAGTAACTTTCGCTGCTACA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGGACTCTCTGCAAAGCTCGTACCTCCGGCATGCCAAGTGGGACAAGTACGCGCGCCTCA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATCCGTTCTGGGCATCCGGACAGTCCTGGAGGCGGCTCCGCACGGACGCCCAGGCTGGTA 360

                           | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 T-CTCCGGCAGTCGCCTGAGGCAGGCCTACAATATCTGGGAGCAGGGAGGTCAAATGCTC 420

                           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     421 ACCGAGTACATGACGCAACAGGTGGCGGA-GAAGAACAATATTCTGGAGACCAGAGATCT 480

18559R-2.IR_full       481 CTGCTTCCGATACACGGCCCAT 502
                           |||||||||||||||||||||| silico     481 CTGCTTCCGATACACGGCCCAT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134845.1  CG18559-RA (Cyp309a2), mRNA 
0   25  NM_134844.2  CG9964-RA (Cyp309a1), mRNA 
0   NM_080521.2  CG31507-RA (TotZ), mRNA 
0   NM_132207.2  CG1571-RA (CG1571), mRNA 
0   NM_137176.1  CG8093-RA (CG8093), mRNA 
0   NM_134680.1  CG13691-RA (BBS8), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_134730.2  CG5041-RA (Tfb4), mRNA 
0   NM_168352.1  CG32048-RA, transcript variant A (CG32048), mRNA 
0   NM_057480.4  CG9116-RA (LysP), mRNA 
0   NM_165318.1  CG10895-RC, transcript variant C (lok), mRNA 
0   NM_057870.3  CG10895-RB, transcript variant B (lok), mRNA 
0   NM_057871.3  CG10895-RA, transcript variant A (lok), mRNA 
0   NM_206657.1  CG1634-RC, transcript variant C (Nrg), mRNA 
0   NM_167160.1  CG1634-RB, transcript variant B (Nrg), mRNA 
0   NM_078535.2  CG1634-RA, transcript variant A (Nrg), mRNA 
0   11  NM_170412.1  CG2010-RA, transcript variant A (CG2010), mRNA 
0   11  NM_143439.2  CG2010-RB, transcript variant B (CG2010), mRNA 
0   NM_142218.1  CG18522-RA (CG18522), mRNA 
0   NM_176406.1  CG12746-RD, transcript variant D (CG12746), mRNA 
0   NM_169067.2  CG12746-RB, transcript variant B (CG12746), mRNA 
0   NM_169065.1  CG12746-RA, transcript variant A (CG12746), mRNA 
0   NM_141294.3  CG12746-RC, transcript variant C (CG12746), mRNA 
0   NM_167892.1  CG1049-RB, transcript variant B (Cct1), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   19  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   15  NM_132796.2  CG11655-RA (CG11655), mRNA 
0   14  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_137659.2  CG11132-RA (DMAP1), mRNA 
0   NM_130545.2  CG11411-RA (fs(1)N), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.