National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18559R-1 
 Symbol Cyp309a2  Full Name Cyp309a2 
 CG No CG18559  Old CG No CG18559 
 Synonyms 309a2, CG18559, Cyp309a2 
 Accession No (Link to NCBI) NM_134845.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCACCACAAGTACTGGCGCA 
 Primer Seq. 3'
aatctagaggtaccATGGGCCGTGTATCGGAAGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGNACCACAA GTACTGGCGC AAGCGGGGAT TGGTCACGGC GCGGNCCCTG ACCCTGCTGG 
0061 GCACGTATCC GGGCCTGCTC ACCCGCAAGA GCAATCTGGT CTTCGACGTG CAGAAGATCT 
0121 ATGATAAATA CAAGGGGAAG CACCGAGCTG TTGGCGTCTT TGTGACCCGA CAGCCGCAGA 
0181 TCCTGGTCCT CGATCCGGAG CTGGCCCACG AAGTGCTGGT GAGTAACTTT CGCTGCTACA 
0241 AGGACTCTCT GCAAAGCTCG TACCTCCGGC ATGCCAAGTG GGACAAGTAC GCGCGCCTCA 
0301 ATCCGTTCTG GGCATCCGGA CAGTCCTGGA GGCGGCTCCG CACGGACGCC CAGGCTGGTA 
0361 TNCTCCGGCA GTCgCCTGAG GCAGGCCTAC AATATCTGGG AGCAGGGAGG TCAAATGCTC 
0421 ACCGAGTACA TGACGCAACA GGTGGCGGAN GAAGAACAAT ATTCTGGAGA CCAGAGATCT 
0481 CTGCTTCCGA TACACGGCCC AT 
 in silico PCR Fragment
0001 GGCACCACAA GTACTGGCGC AAGCGGGGAT TGGTCACGGC GCGGCCCCTG ACCCTGCTGG 
0061 GCACGTATCC GGGCCTGCTC ACCCGCAAGA GCAATCTGGT CTTCGACGTG CAGAAGATCT 
0121 ATGATAAATA CAAGGGGAAG CACCGAGCTG TTGGCGTCTT TGTGACCCGA CAGCCGCAGA 
0181 TCCTGGTCCT CGATCCGGAG CTGGCCCACG AAGTGCTGGT GAGTAACTTT CGCTGCTACA 
0241 AGGACTCTCT GCAAAGCTCG TACCTCCGGC ATGCCAAGTG GGACAAGTAC GCGCGCCTCA 
0301 ATCCGTTCTG GGCATCCGGA CAGTCCTGGA GGCGGCTCCG CACGGACGCC CAGGCTGGTA 
0361 T-CTCCGGCA GTCGCCTGAG GCAGGCCTAC AATATCTGGG AGCAGGGAGG TCAAATGCTC 
0421 ACCGAGTACA TGACGCAACA GGTGGCGGA- GAAGAACAAT ATTCTGGAGA CCAGAGATCT 
0481 CTGCTTCCGA TACACGGCCC AT 
 Assemble Data

18559R-1.IR_full       1   GGNACCACAAGTACTGGCGCAAGCGGGGATTGGTCACGGCGCGGNCCCTGACCCTGCTGG 60
                           || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
18559R-1.in silico     1   GGCACCACAAGTACTGGCGCAAGCGGGGATTGGTCACGGCGCGGCCCCTGACCCTGCTGG 60


18559R-1.IR_full       61  GCACGTATCCGGGCCTGCTCACCCGCAAGAGCAATCTGGTCTTCGACGTGCAGAAGATCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18559R-1.in silico     61  GCACGTATCCGGGCCTGCTCACCCGCAAGAGCAATCTGGTCTTCGACGTGCAGAAGATCT 120


18559R-1.IR_full       121 ATGATAAATACAAGGGGAAGCACCGAGCTGTTGGCGTCTTTGTGACCCGACAGCCGCAGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18559R-1.in silico     121 ATGATAAATACAAGGGGAAGCACCGAGCTGTTGGCGTCTTTGTGACCCGACAGCCGCAGA 180


18559R-1.IR_full       181 TCCTGGTCCTCGATCCGGAGCTGGCCCACGAAGTGCTGGTGAGTAACTTTCGCTGCTACA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18559R-1.in silico     181 TCCTGGTCCTCGATCCGGAGCTGGCCCACGAAGTGCTGGTGAGTAACTTTCGCTGCTACA 240


18559R-1.IR_full       241 AGGACTCTCTGCAAAGCTCGTACCTCCGGCATGCCAAGTGGGACAAGTACGCGCGCCTCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18559R-1.in silico     241 AGGACTCTCTGCAAAGCTCGTACCTCCGGCATGCCAAGTGGGACAAGTACGCGCGCCTCA 300


18559R-1.IR_full       301 ATCCGTTCTGGGCATCCGGACAGTCCTGGAGGCGGCTCCGCACGGACGCCCAGGCTGGTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18559R-1.in silico     301 ATCCGTTCTGGGCATCCGGACAGTCCTGGAGGCGGCTCCGCACGGACGCCCAGGCTGGTA 360


18559R-1.IR_full       361 TNCTCCGGCAGTCGCCTGAGGCAGGCCTACAATATCTGGGAGCAGGGAGGTCAAATGCTC 420
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18559R-1.in silico     361 T-CTCCGGCAGTCGCCTGAGGCAGGCCTACAATATCTGGGAGCAGGGAGGTCAAATGCTC 420


18559R-1.IR_full       421 ACCGAGTACATGACGCAACAGGTGGCGGANGAAGAACAATATTCTGGAGACCAGAGATCT 480
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
18559R-1.in silico     421 ACCGAGTACATGACGCAACAGGTGGCGGA-GAAGAACAATATTCTGGAGACCAGAGATCT 480


18559R-1.IR_full       481 CTGCTTCCGATACACGGCCCAT 502
                           ||||||||||||||||||||||
18559R-1.in silico     481 CTGCTTCCGATACACGGCCCAT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134845.1  CG18559-RA (Cyp309a2), mRNA 
0   25  NM_134844.2  CG9964-RA (Cyp309a1), mRNA 
0   NM_080521.2  CG31507-RA (TotZ), mRNA 
0   NM_132207.2  CG1571-RA (CG1571), mRNA 
0   NM_137176.1  CG8093-RA (CG8093), mRNA 
0   NM_134680.1  CG13691-RA (BBS8), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_134730.2  CG5041-RA (Tfb4), mRNA 
0   NM_168352.1  CG32048-RA, transcript variant A (CG32048), mRNA 
0   NM_057480.4  CG9116-RA (LysP), mRNA 
0   NM_165318.1  CG10895-RC, transcript variant C (lok), mRNA 
0   NM_057870.3  CG10895-RB, transcript variant B (lok), mRNA 
0   NM_057871.3  CG10895-RA, transcript variant A (lok), mRNA 
0   NM_206657.1  CG1634-RC, transcript variant C (Nrg), mRNA 
0   NM_167160.1  CG1634-RB, transcript variant B (Nrg), mRNA 
0   NM_078535.2  CG1634-RA, transcript variant A (Nrg), mRNA 
0   11  NM_170412.1  CG2010-RA, transcript variant A (CG2010), mRNA 
0   11  NM_143439.2  CG2010-RB, transcript variant B (CG2010), mRNA 
0   NM_142218.1  CG18522-RA (CG18522), mRNA 
0   NM_176406.1  CG12746-RD, transcript variant D (CG12746), mRNA 
0   NM_169067.2  CG12746-RB, transcript variant B (CG12746), mRNA 
0   NM_169065.1  CG12746-RA, transcript variant A (CG12746), mRNA 
0   NM_141294.3  CG12746-RC, transcript variant C (CG12746), mRNA 
0   NM_167892.1  CG1049-RB, transcript variant B (Cct1), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   19  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   15  NM_132796.2  CG11655-RA (CG11655), mRNA 
0   14  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_137659.2  CG11132-RA (DMAP1), mRNA 
0   NM_130545.2  CG11411-RA (fs(1)N), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.