National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18543R-3 
 Symbol mtrm  Full Name matrimony 
 CG No CG18543  Old CG No CG18543 
 Synonyms CG18543, D52, anonD52, anon-D52, mtrm 
 Accession No (Link to NCBI) NM_139966.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAGAATTCTCGCACGCCC 
 Primer Seq. 3'
aatctagaggtaccGTTCCACATTGGCGGCATGGT 
 Predicted Fragment Size
490 
 IR fragment full Seq
0001 ATGGAGAATT CTCGCACGCC CACGAACAAG ACCAAAATTA CGCTTAATCG CACGCCAACG 
0061 CTAAAGGAGC GCAGATGGAA CACCCTGAAG GTGAACACCT CCAACGTGCG ATGCTCTACT 
0121 CCGATCTTTG GCAACTTCCG TTCGCCCAAT CTCTCGCCCA TCGAGAATAT GGGCACGAAG 
0181 GGGAAGAGTC CAGTGTCGCC CATGCGGTTC GCTACCTTCA AGAAAGTGCC AACGAAGGTG 
0241 CATCCCAAGC AGCAGCAGCA GCAGCAGCAT CAGCACTGCC ATCGCACTCA GCTTAAGCCC 
0301 CCGCCATTCG TGCTGCCCAA GCCGCAGGAG GAGATCATCG AGCCGGAGCG AGAAATAAAG 
0361 AGCTGCAGCA GCCCGGATAC CTGTTCGGAT GACTCGAATA TGGAGACCTC ACTGGCCTTG 
0421 GAGTCGCGTC GTCGTTCCAT CAAAGCATCG AACCACTCGT ACGTGGTTAA CCATGCCGCC 
0481 AATGTGGAAC  
 in silico PCR Fragment
0001 ATGGAGAATT CTCGCACGCC CACGAACAAG ACCAAAATTA CGCTTAATCG CACGCCAACG 
0061 CTAAAGGAGC GCAGATGGAA CACCCTGAAG GTGAACACCT CCAACGTGCG ATGCTCTACT 
0121 CCGATCTTTG GCAACTTCCG TTCGCCCAAT CTCTCGCCCA TCGAGAATAT GGGCACGAAG 
0181 GGGAAGAGTC CAGTGTCGCC CATGCGGTTC GCTACCTTCA AGAAAGTGCC AACGAAGGTG 
0241 CATCCCAAGC AGCAGCAGCA GCAGCAGCAT CAGCACTGCC ATCGCACTCA GCTTAAGCCC 
0301 CCGCCATTCG TGCTGCCCAA GCCGCAGGAG GAGATCATCG AGCCGGAGCG AGAAATAAAG 
0361 AGCTGCAGCA GCCCGGATAC CTGTTCGGAT GACTCGAATA TGGAGACCTC ACTGGCCTTG 
0421 GAGTCGCGTC GTCGTTCCAT CAAAGCATCG AACCACTCGT ACGTGGTTAA CCATGCCGCC 
0481 AATGTGGAAC  
 Assemble Data

18543R-3.IR_full       1   ATGGAGAATTCTCGCACGCCCACGAACAAGACCAAAATTACGCTTAATCGCACGCCAACG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18543R-3.in silico     1   ATGGAGAATTCTCGCACGCCCACGAACAAGACCAAAATTACGCTTAATCGCACGCCAACG 60


18543R-3.IR_full       61  CTAAAGGAGCGCAGATGGAACACCCTGAAGGTGAACACCTCCAACGTGCGATGCTCTACT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18543R-3.in silico     61  CTAAAGGAGCGCAGATGGAACACCCTGAAGGTGAACACCTCCAACGTGCGATGCTCTACT 120


18543R-3.IR_full       121 CCGATCTTTGGCAACTTCCGTTCGCCCAATCTCTCGCCCATCGAGAATATGGGCACGAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18543R-3.in silico     121 CCGATCTTTGGCAACTTCCGTTCGCCCAATCTCTCGCCCATCGAGAATATGGGCACGAAG 180


18543R-3.IR_full       181 GGGAAGAGTCCAGTGTCGCCCATGCGGTTCGCTACCTTCAAGAAAGTGCCAACGAAGGTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18543R-3.in silico     181 GGGAAGAGTCCAGTGTCGCCCATGCGGTTCGCTACCTTCAAGAAAGTGCCAACGAAGGTG 240


18543R-3.IR_full       241 CATCCCAAGCAGCAGCAGCAGCAGCAGCATCAGCACTGCCATCGCACTCAGCTTAAGCCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18543R-3.in silico     241 CATCCCAAGCAGCAGCAGCAGCAGCAGCATCAGCACTGCCATCGCACTCAGCTTAAGCCC 300


18543R-3.IR_full       301 CCGCCATTCGTGCTGCCCAAGCCGCAGGAGGAGATCATCGAGCCGGAGCGAGAAATAAAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18543R-3.in silico     301 CCGCCATTCGTGCTGCCCAAGCCGCAGGAGGAGATCATCGAGCCGGAGCGAGAAATAAAG 360


18543R-3.IR_full       361 AGCTGCAGCAGCCCGGATACCTGTTCGGATGACTCGAATATGGAGACCTCACTGGCCTTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18543R-3.in silico     361 AGCTGCAGCAGCCCGGATACCTGTTCGGATGACTCGAATATGGAGACCTCACTGGCCTTG 420


18543R-3.IR_full       421 GAGTCGCGTCGTCGTTCCATCAAAGCATCGAACCACTCGTACGTGGTTAACCATGCCGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18543R-3.in silico     421 GAGTCGCGTCGTCGTTCCATCAAAGCATCGAACCACTCGTACGTGGTTAACCATGCCGCC 480


18543R-3.IR_full       481 AATGTGGAAC 490
                           ||||||||||
18543R-3.in silico     481 AATGTGGAAC 490

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.42  474  18  16  16  NM_139966.2  CG18543-RA (mtrm), mRNA 
25.21   119  525  1005  1281  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
25.21   119  525  1005  1281  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
25.21   119  525  1005  1281  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
8.47   40  124  173  269  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
8.47   40  124  173  269  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
8.26   39  82  56  74  NM_144114.3  CG14494-RA (CG14494), mRNA 
7.41   35  82  51  50  NM_144133.1  CG13235-RA (CG13235), mRNA 
6.99   33  170  482  759  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
6.99   33  170  482  759  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
6.35   30  84  115  228  NM_167239.2  CG32677-RA (CG32677), mRNA 
6.35   30  68  50  50  NM_136061.1  CG15166-RA (CG15166), mRNA 
6.14   29  81  129  247  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
5.72   27  128  270  468  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
5.72   27  128  270  468  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
5.72   27  59  76  114  NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 
5.72   27  59  76  114  NM_206242.1  CG32306-RD, transcript variant D (CG32306), mRNA 
5.72   27  58  40  39  NM_176711.2  CG1543-RB (Tbh), mRNA 
5.5   26  128  283  476  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
5.5   26  119  227  372  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
5.5   26  78  87  143  NM_133012.2  CG32560-RA (CG32560), mRNA 
5.5   26  49  28  49  NM_166948.1  CG2621-RF, transcript variant F (sgg), mRNA 
5.5   26  49  28  49  NM_166947.1  CG2621-RE, transcript variant E (sgg), mRNA 
5.5   26  49  28  49  NM_057367.3  CG2621-RB, transcript variant B (sgg), mRNA 
5.5   26  49  28  49  NM_206614.1  CG2621-RI, transcript variant I (sgg), mRNA 
5.5   26  49  28  49  NM_206615.1  CG2621-RH, transcript variant H (sgg), mRNA 
5.5   26  49  28  49  NM_134278.2  CG2621-RC, transcript variant C (sgg), mRNA 
5.5   26  49  27  53  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
5.5   26  49  27  43  NM_206612.1  CG2621-RG, transcript variant G (sgg), mRNA 
5.5   26  49  27  43  NM_206611.1  CG2621-RK, transcript variant K (sgg), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.