National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18543R-2 
 Symbol mtrm  Full Name matrimony 
 CG No CG18543  Old CG No CG18543 
 Synonyms CG18543, D52, anonD52, anon-D52, mtrm 
 Accession No (Link to NCBI) NM_139966.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGAGAATTCTCGCACGCCCACGAACAAGACCAAAATTACGCTTAATCGCACGCCAACG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTAAAGGAGCGCAGATGGAACACCCTGAAGGTGAACACCTCCAACGTGCGATGCTCTACT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCGATCTTTGGCAACTTCCGTTCGCCCAATCTCTCGCCCATCGAGAATATGGGCACGAAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGGAAGAGTCCAGTGTCGCCCATGCGGTTCGCTACCTTCAAGAAAGTGCCAACGAAGGTG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATCCCAAGCAGCAGCAGCAGCAGCAGCATCAGCACTGCCATCGCACTCAGCTTAAGCCC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCGCCATTCGTGCTGCCCAAGCCGCAGGAGGAGATCATCGAGCCGGAGCGAGAAATAAAG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGCTGCAGCAGCCCGGATACCTGTTCGGATGACTCGAATATGGAGACCTCACTGGCCTTG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGTCGCGTCGTCGTTCCATCAAAGCATCGAACCACTCGTACGTGGTTAACCATGCCGCC 480

18543R-2.IR_full       481 AATGTGGAAC 490
                           |||||||||| silico     481 AATGTGGAAC 490

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.42  474  18  16  16  NM_139966.2  CG18543-RA (mtrm), mRNA 
25.21   119  525  1005  1281  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
25.21   119  525  1005  1281  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
25.21   119  525  1005  1281  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
8.47   40  124  173  269  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
8.47   40  124  173  269  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
8.26   39  82  56  74  NM_144114.3  CG14494-RA (CG14494), mRNA 
7.41   35  82  51  50  NM_144133.1  CG13235-RA (CG13235), mRNA 
6.99   33  170  482  759  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
6.99   33  170  482  759  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
6.35   30  84  115  228  NM_167239.2  CG32677-RA (CG32677), mRNA 
6.35   30  68  50  50  NM_136061.1  CG15166-RA (CG15166), mRNA 
6.14   29  81  129  247  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
5.72   27  128  270  468  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
5.72   27  128  270  468  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
5.72   27  59  76  114  NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 
5.72   27  59  76  114  NM_206242.1  CG32306-RD, transcript variant D (CG32306), mRNA 
5.72   27  58  40  39  NM_176711.2  CG1543-RB (Tbh), mRNA 
5.5   26  128  283  476  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
5.5   26  119  227  372  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
5.5   26  78  87  143  NM_133012.2  CG32560-RA (CG32560), mRNA 
5.5   26  49  28  49  NM_166948.1  CG2621-RF, transcript variant F (sgg), mRNA 
5.5   26  49  28  49  NM_166947.1  CG2621-RE, transcript variant E (sgg), mRNA 
5.5   26  49  28  49  NM_057367.3  CG2621-RB, transcript variant B (sgg), mRNA 
5.5   26  49  28  49  NM_206614.1  CG2621-RI, transcript variant I (sgg), mRNA 
5.5   26  49  28  49  NM_206615.1  CG2621-RH, transcript variant H (sgg), mRNA 
5.5   26  49  28  49  NM_134278.2  CG2621-RC, transcript variant C (sgg), mRNA 
5.5   26  49  27  53  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
5.5   26  49  27  43  NM_206612.1  CG2621-RG, transcript variant G (sgg), mRNA 
5.5   26  49  27  43  NM_206611.1  CG2621-RK, transcript variant K (sgg), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.