National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18480R-2 
 Symbol CG18480  Full Name CG18480 
 CG No CG18480  Old CG No CG18480 
 Synonyms CT42128, BG:DS07108.4, BcDNA:LP11031, CG18480 
 Accession No (Link to NCBI) NM_135917.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTGGTTGGGCCTTAAGCAG 
 Primer Seq. 3'
aatctagaggtaccGCGCAGATTGAGAGAGCGTAG 
 Predicted Fragment Size
504 
 IR fragment full Seq
0001 ATGTGGTTGG GCCTTAAGCA GATCCTTCTC TATGTAGGCC TGTTGCTCTG CGTTCTTCTG 
0061 CAGGTCTGCA GAAGCAAGAC CCAGTCGCAG ATGTTTTGCC CCACTGTTTG CCACTGTGAT 
0121 CTACACGCCC AGCGCAATCG CGCAGTATGC AGCgCAAAGC GCTTGATAAG CGCCAATATA 
0181 GAAATACCTA CAACGGTTGA GCTGTTGGAC CTGAGCTACA ATGATATAAC CACCATTGAC 
0241 GATGACTCCT TCAAAACCAC AATCCACCTG CTTAATCTTA CGTTGGCCCA CAACGCGATA 
0301 CACACACTTT ATGGGGATGC CTTTGTGGAG TTGACCAGAC TACGCTACTT GGATCTATCG 
0361 TACAATCGCC TGGAGCAGAT CGATGAACAT ATCCTGGAAT CCAACAACCA ACTGATCCAC 
0421 CTTAATTTGG AAGGCAACAA GTTGTCCACA TTGGGAAAAG GACCTATATT AAGAAGTCCA 
0481 TCGCTACGCT CTCTCAATCT GCGC 
 in silico PCR Fragment
0001 ATGTGGTTGG GCCTTAAGCA GATACTTCTC TATGTAGGCC TGTTGCTCTG CGTTCTTCTG 
0061 CAGGTCTGCA GAAGCAAGAC CCAGTCGCAG ATGTTTTGCC CCACTGTTTG CCACTGTGAT 
0121 CTACACGCCC AGCGCAATCG CGCAGTATGC AGCGCAAAGC GCTTGATAAG CGCCAATATA 
0181 GAAATACCTA CAACGGTTGA GCTGTTGGAC CTGAGCTACA ATGATATAAC CACCATTGAC 
0241 GATGACTCCT TCAAAACCAC AATCCACCTG CTTAATCTTA CGTTGGCCCA CAACGCGATA 
0301 CACACACTTT ATGGGGATGC CTTTGTGGAG TTGACCAGAC TACGCTACTT GGATCTATCG 
0361 TACAATCGCC TGGAGCAGAT CGATGAACAT ATCCTGGAAT CCAACAACCA ACTGATCCAC 
0421 CTTAATTTGG AAGGCAACAA GTTGTCCACA TTGGGAAAAG GACCTATATT AAGAAGTCCA 
0481 TCGCTACGCT CTCTCAATCT GCGC 
 Assemble Data

18480R-2.IR_full       1   ATGTGGTTGGGCCTTAAGCAGATCCTTCTCTATGTAGGCCTGTTGCTCTGCGTTCTTCTG 60
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
18480R-2.in silico     1   ATGTGGTTGGGCCTTAAGCAGATACTTCTCTATGTAGGCCTGTTGCTCTGCGTTCTTCTG 60


18480R-2.IR_full       61  CAGGTCTGCAGAAGCAAGACCCAGTCGCAGATGTTTTGCCCCACTGTTTGCCACTGTGAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18480R-2.in silico     61  CAGGTCTGCAGAAGCAAGACCCAGTCGCAGATGTTTTGCCCCACTGTTTGCCACTGTGAT 120


18480R-2.IR_full       121 CTACACGCCCAGCGCAATCGCGCAGTATGCAGCGCAAAGCGCTTGATAAGCGCCAATATA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18480R-2.in silico     121 CTACACGCCCAGCGCAATCGCGCAGTATGCAGCGCAAAGCGCTTGATAAGCGCCAATATA 180


18480R-2.IR_full       181 GAAATACCTACAACGGTTGAGCTGTTGGACCTGAGCTACAATGATATAACCACCATTGAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18480R-2.in silico     181 GAAATACCTACAACGGTTGAGCTGTTGGACCTGAGCTACAATGATATAACCACCATTGAC 240


18480R-2.IR_full       241 GATGACTCCTTCAAAACCACAATCCACCTGCTTAATCTTACGTTGGCCCACAACGCGATA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18480R-2.in silico     241 GATGACTCCTTCAAAACCACAATCCACCTGCTTAATCTTACGTTGGCCCACAACGCGATA 300


18480R-2.IR_full       301 CACACACTTTATGGGGATGCCTTTGTGGAGTTGACCAGACTACGCTACTTGGATCTATCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18480R-2.in silico     301 CACACACTTTATGGGGATGCCTTTGTGGAGTTGACCAGACTACGCTACTTGGATCTATCG 360


18480R-2.IR_full       361 TACAATCGCCTGGAGCAGATCGATGAACATATCCTGGAATCCAACAACCAACTGATCCAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18480R-2.in silico     361 TACAATCGCCTGGAGCAGATCGATGAACATATCCTGGAATCCAACAACCAACTGATCCAC 420


18480R-2.IR_full       421 CTTAATTTGGAAGGCAACAAGTTGTCCACATTGGGAAAAGGACCTATATTAAGAAGTCCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18480R-2.in silico     421 CTTAATTTGGAAGGCAACAAGTTGTCCACATTGGGAAAAGGACCTATATTAAGAAGTCCA 480


18480R-2.IR_full       481 TCGCTACGCTCTCTCAATCTGCGC 504
                           ||||||||||||||||||||||||
18480R-2.in silico     481 TCGCTACGCTCTCTCAATCTGCGC 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   486  NM_135917.2  CG18480-RA (CG18480), mRNA 
0   NM_137717.2  CG15658-RA (CG15658), mRNA 
0   NM_079285.2  CG8308-RA (alphaTub67C), mRNA 
0   NM_206372.1  CG7945-RC, transcript variant C (CG7945), mRNA 
0   NM_140516.1  CG7945-RB, transcript variant B (CG7945), mRNA 
0   NM_168624.1  CG7945-RA, transcript variant A (CG7945), mRNA 
0   NM_140097.1  CG6749-RA (CG6749), mRNA 
0   NM_135706.2  CG16996-RA (CG16996), mRNA 
0   NM_205880.1  CG2674-RE, transcript variant E (M(2)21AB), mRNA 
0   NM_164361.1  CG2674-RB, transcript variant B (M(2)21AB), mRNA 
0   NM_164356.1  CG2674-RA, transcript variant A (M(2)21AB), mRNA 
0   NM_132385.2  CG2967-RA (CG2967), mRNA 
0   NM_137034.2  CG17064-RA (mars), mRNA 
0   NM_176271.1  CG2469-RB, transcript variant B (CG2469), mRNA 
0   NM_176270.1  CG2469-RA, transcript variant A (CG2469), mRNA 
0   NM_078490.2  CG4528-RA (snf), mRNA 
0   11  NM_135896.3  CG4168-RA (CG4168), mRNA 
0   NM_139674.2  CG7509-RA (CG7509), mRNA 
0   NM_137403.3  CG14485-RA (swi2), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 
0   NM_141017.2  CG12983-RA (CG12983), mRNA 
0   NM_142988.2  CG5728-RA (CG5728), mRNA 
0   NM_206596.1  CG4122-RG, transcript variant G (svr), mRNA 
0   NM_206597.1  CG4122-RF, transcript variant F (svr), mRNA 
0   NM_080293.3  CG4122-RB, transcript variant B (svr), mRNA 
0   NM_176679.2  CG4122-RC, transcript variant C (svr), mRNA 
0   NM_206598.2  CG4122-RE, transcript variant E (svr), mRNA 
0   NM_206599.1  CG4122-RD, transcript variant D (svr), mRNA 
0   NM_166846.3  CG4122-RA, transcript variant A (svr), mRNA 
0   NM_079679.2  CG5557-RA (sqz), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.