National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18477R-5 
 Symbol CG18477  Full Name CG18477 
 CG No CG18477  Old CG No CG18477 
 Synonyms SPH69, BG:DS07108.1, CG18477 
 Accession No (Link to NCBI) NM_135919.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGCCTTGC-TGGATGCCAGAACCAGCAGCTATGTGGCCGGTGGCGCCCTCATCGCTCCAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGTAGTGATCACGGCCAGGCAAAGAACCGAAAACATGACCGCAAGCCAGCTTGTTGTGC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAGCTGGCGAATGGGACTTCAGCACCAAAACCGAGCAGCTTCCTTCTGTGGACGTTCCTA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTCGGTCAATTGTCCGTCATCCTGGCTTCAATTTAGAGAATGGGGCCAATAATGTGGCCC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTGTGTTTCTTCGCAGATCGCTCACCAGCTCGCGCCACATAAATCCAATATGTATGCCGT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGGCTCCAAAGAATTTTGACTTTAGCCGGTGCATATTTACGGGCTGGGGAAAGAATTCCT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTGACGATCCCTCCTATATGAATGTCCTGAAAAAAATATCATTGCCGGTGGTCCAAAGGC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GTACCTGTGAGCAGCAACTTCGCCTCTATTACGGAAACGATTTTGAACTGGACAACAGCT 480

18477R-5.IR_full       481 TAATGTGCGCAGGCGGTGANC 501
                           ||||||||||||||||||| | silico     481 TAATGTGCGCAGGCGGTGAGC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165119.1  CG31780-RB (CG31780), mRNA 
100   482  NM_135919.1  CG18477-RA (CG18477), mRNA 
0.41   NM_134801.1  CG4259-RA (CG4259), mRNA 
0.41   NM_206072.1  CG33478-RA, transcript variant A (Or46a), mRNA 
0   13  NM_135530.2  CG5390-RA (CG5390), mRNA 
0   NM_142301.1  CG14889-RA (CG14889), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   24  17  NM_165139.1  CG4793-RC, transcript variant C (CG4793), mRNA 
0   24  17  NM_135929.2  CG4793-RB, transcript variant B (CG4793), mRNA 
0   NM_001031898.1  CG33935-RA, transcript variant A (mei-217), mRNA 
0   NM_001031897.1  CG8923-RC, transcript variant C (mei-218), mRNA 
0   NM_167557.2  CG8923-RB, transcript variant B (mei-218), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0   NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   NM_166029.1  CG30482-RA (CG30482), mRNA 
0   NM_132483.2  CG1737-RA (CG1737), mRNA 
0   10  NM_134878.1  CG3117-RA (CG3117), mRNA 
0   NM_001015243.1  CG40460-PC.3 (CG40460), mRNA 
0   NM_001015245.1  CG40460-PF.3 (CG40460), partial mRNA 
0   NM_001015247.1  CG40460-PJ.3 (CG40460), mRNA 
0   NM_001015246.1  CG40460-PI.3 (CG40460), mRNA 
0   NM_001015248.1  CG40460-PE.3 (CG40460), mRNA 
0   NM_001015249.1  CG40460-PH.3 (CG40460), mRNA 
0   NM_001015251.1  CG40460-PB.3 (CG40460), mRNA 
0   NM_001015250.1  CG40460-PK.3 (CG40460), mRNA 
0   NM_001015252.1  CG40460-PG.3 (CG40460), mRNA 
0   NM_001015244.1  CG40460-PD.3 (CG40460), mRNA 
0   NM_140385.2  CG10724-RA, transcript variant A (CG10724), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.