National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18477R-3 
 Symbol CG18477  Full Name CG18477 
 CG No CG18477  Old CG No CG18477 
 Synonyms SPH69, BG:DS07108.1, CG18477 
 Accession No (Link to NCBI) NM_135919.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCCTTGCTGGATGCCAGAAC 
 Primer Seq. 3'
aatctagaggtaccGCTCACCGCCTGCGCACATTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gGNCTTGCAT GGATGCCAGA ACCAGCAGCT ATGTGGCCGG TGGcGCCCTC ATCGCTCCAC 
0061 ATGTAGTGAT CACGGCCAGG CAAAGAACCG AAAACATGAC CGCAAGCCAG CTTGTTGTGC 
0121 GAGCTGGCGA ATGGGACTTC AGCACCAAAA CCGAGCAGCT TCCTTCTGTG GACGTTCCTA 
0181 TTCGGTCAAT TGTCCGTCAT CCTGGCTTCA ATTTAGAGAA TGGGGCCAAT AATGTGGCCC 
0241 TTGTGTTTCT TCGCAGATCG CTCACCAGCT CGCGCCACAT AAATCCAATA TGTATGCCGT 
0301 CGGCTCCAAA GAATTTTGAC TTTAGCCGGT GCATATTTAC GGGCTGGGGA AAGAATTCCT 
0361 TTGACGATCC CTCCTATATG AATGTCCTGA AAAAAATATC ATTGCCGGTG GTCCAAAGGC 
0421 GTACCTGTGA GCAGCAACTT CGCCTCTATT ACGGAAACGA TTTTGAACTG GACAACAGCT 
0481 TAATGTGCGC AGGCGGTGAN C 
 in silico PCR Fragment
0001 GGCCTTGC-T GGATGCCAGA ACCAGCAGCT ATGTGGCCGG TGGCGCCCTC ATCGCTCCAC 
0061 ATGTAGTGAT CACGGCCAGG CAAAGAACCG AAAACATGAC CGCAAGCCAG CTTGTTGTGC 
0121 GAGCTGGCGA ATGGGACTTC AGCACCAAAA CCGAGCAGCT TCCTTCTGTG GACGTTCCTA 
0181 TTCGGTCAAT TGTCCGTCAT CCTGGCTTCA ATTTAGAGAA TGGGGCCAAT AATGTGGCCC 
0241 TTGTGTTTCT TCGCAGATCG CTCACCAGCT CGCGCCACAT AAATCCAATA TGTATGCCGT 
0301 CGGCTCCAAA GAATTTTGAC TTTAGCCGGT GCATATTTAC GGGCTGGGGA AAGAATTCCT 
0361 TTGACGATCC CTCCTATATG AATGTCCTGA AAAAAATATC ATTGCCGGTG GTCCAAAGGC 
0421 GTACCTGTGA GCAGCAACTT CGCCTCTATT ACGGAAACGA TTTTGAACTG GACAACAGCT 
0481 TAATGTGCGC AGGCGGTGAG C 
 Assemble Data

18477R-3.IR_full       1   GGNCTTGCATGGATGCCAGAACCAGCAGCTATGTGGCCGGTGGCGCCCTCATCGCTCCAC 60
                           || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
18477R-3.in silico     1   GGCCTTGC-TGGATGCCAGAACCAGCAGCTATGTGGCCGGTGGCGCCCTCATCGCTCCAC 60


18477R-3.IR_full       61  ATGTAGTGATCACGGCCAGGCAAAGAACCGAAAACATGACCGCAAGCCAGCTTGTTGTGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18477R-3.in silico     61  ATGTAGTGATCACGGCCAGGCAAAGAACCGAAAACATGACCGCAAGCCAGCTTGTTGTGC 120


18477R-3.IR_full       121 GAGCTGGCGAATGGGACTTCAGCACCAAAACCGAGCAGCTTCCTTCTGTGGACGTTCCTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18477R-3.in silico     121 GAGCTGGCGAATGGGACTTCAGCACCAAAACCGAGCAGCTTCCTTCTGTGGACGTTCCTA 180


18477R-3.IR_full       181 TTCGGTCAATTGTCCGTCATCCTGGCTTCAATTTAGAGAATGGGGCCAATAATGTGGCCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18477R-3.in silico     181 TTCGGTCAATTGTCCGTCATCCTGGCTTCAATTTAGAGAATGGGGCCAATAATGTGGCCC 240


18477R-3.IR_full       241 TTGTGTTTCTTCGCAGATCGCTCACCAGCTCGCGCCACATAAATCCAATATGTATGCCGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18477R-3.in silico     241 TTGTGTTTCTTCGCAGATCGCTCACCAGCTCGCGCCACATAAATCCAATATGTATGCCGT 300


18477R-3.IR_full       301 CGGCTCCAAAGAATTTTGACTTTAGCCGGTGCATATTTACGGGCTGGGGAAAGAATTCCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18477R-3.in silico     301 CGGCTCCAAAGAATTTTGACTTTAGCCGGTGCATATTTACGGGCTGGGGAAAGAATTCCT 360


18477R-3.IR_full       361 TTGACGATCCCTCCTATATGAATGTCCTGAAAAAAATATCATTGCCGGTGGTCCAAAGGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18477R-3.in silico     361 TTGACGATCCCTCCTATATGAATGTCCTGAAAAAAATATCATTGCCGGTGGTCCAAAGGC 420


18477R-3.IR_full       421 GTACCTGTGAGCAGCAACTTCGCCTCTATTACGGAAACGATTTTGAACTGGACAACAGCT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18477R-3.in silico     421 GTACCTGTGAGCAGCAACTTCGCCTCTATTACGGAAACGATTTTGAACTGGACAACAGCT 480


18477R-3.IR_full       481 TAATGTGCGCAGGCGGTGANC 501
                           ||||||||||||||||||| |
18477R-3.in silico     481 TAATGTGCGCAGGCGGTGAGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165119.1  CG31780-RB (CG31780), mRNA 
100   482  NM_135919.1  CG18477-RA (CG18477), mRNA 
0.41   NM_134801.1  CG4259-RA (CG4259), mRNA 
0.41   NM_206072.1  CG33478-RA, transcript variant A (Or46a), mRNA 
0   13  NM_135530.2  CG5390-RA (CG5390), mRNA 
0   NM_142301.1  CG14889-RA (CG14889), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   24  17  NM_165139.1  CG4793-RC, transcript variant C (CG4793), mRNA 
0   24  17  NM_135929.2  CG4793-RB, transcript variant B (CG4793), mRNA 
0   NM_001031898.1  CG33935-RA, transcript variant A (mei-217), mRNA 
0   NM_001031897.1  CG8923-RC, transcript variant C (mei-218), mRNA 
0   NM_167557.2  CG8923-RB, transcript variant B (mei-218), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0   NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   NM_166029.1  CG30482-RA (CG30482), mRNA 
0   NM_132483.2  CG1737-RA (CG1737), mRNA 
0   10  NM_134878.1  CG3117-RA (CG3117), mRNA 
0   NM_001015243.1  CG40460-PC.3 (CG40460), mRNA 
0   NM_001015245.1  CG40460-PF.3 (CG40460), partial mRNA 
0   NM_001015247.1  CG40460-PJ.3 (CG40460), mRNA 
0   NM_001015246.1  CG40460-PI.3 (CG40460), mRNA 
0   NM_001015248.1  CG40460-PE.3 (CG40460), mRNA 
0   NM_001015249.1  CG40460-PH.3 (CG40460), mRNA 
0   NM_001015251.1  CG40460-PB.3 (CG40460), mRNA 
0   NM_001015250.1  CG40460-PK.3 (CG40460), mRNA 
0   NM_001015252.1  CG40460-PG.3 (CG40460), mRNA 
0   NM_001015244.1  CG40460-PD.3 (CG40460), mRNA 
0   NM_140385.2  CG10724-RA, transcript variant A (CG10724), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.