National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18414R-2 
 Symbol ph-p  Full Name polyhomeotic proximal 
 CG No CG18412  Old CG No CG18414 
 Synonyms ph, PH, CG18412, Ph, PH-p, EG:87B1.5, CG18414, php, ph[P], ph-P, phm, ph-p 
 Accession No (Link to NCBI) NM_057523.3 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Owusu-Ansah E, Banerjee U.
Reactive oxygen species prime Drosophila haematopoietic progenitors for differentiation.
Nature (2009) 461(7263) 537-41 [ PubMed ID = 19727075 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTCGATGATGAATGCTACAG 
 Primer Seq. 3'
aatctagaggtaccCGTGGTTGAAGTTGATGTTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTCGATGAT GAATGCTACA GTGGGTCACC TTTCCANCTG CTCCGCCTGT AACTGTTTCT 
0061 GTGACAAGCA CCGCTGTTAC TTCGTCGCCG GGTCAGCTGG TTCTCTTAAG CACGGCTAGT 
0121 AGCGGTGGAG GAGGTAGCAT ACCAGCCACG CCCACCAAAG AGACACCTTC GAAAGGGCCC 
0181 ACCGCAACCC TGGTGCCCAT TGGTTCGCCC AAGACTCCTG TATCAGGAAA GGACACCTGC 
0241 ACTACCCCCA AATCATCTAC TCCTGCCACT GTTAGCGCAT CCGTAGAGGC CAGTAGTTCC 
0301 ACAGGCGAAG CCCTGTCCAA TGGAGATGCC TCAGATAGGT CTTCCACGCC GTCAAAGGGC 
0361 GCTACCACTC CCACCAGCAA GCAAAGCAAT GCAGCAGTGC AGCCACCGAG TAGCACCACT 
0421 CCCAACAGTG TCAGTGGGAA AGAAGAGCCG AAGCTGGCAA CCTGCGGCAG TTTAACGTCC 
0481 GCAACATCAA CTTCAACCAC G 
 in silico PCR Fragment
0001 CCTCGATGAT GAATGCTACA GTGGGTCACC TTTCCA-CTG CTCCGCCTGT AACTGTTTCT 
0061 GTGACAAGCA CCGCTGTTAC TTCGTCGCCG GGTCAGCTGG TTCTCTTAAG CACGGCTAGT 
0121 AGCGGTGGAG GAGGTAGCAT ACCAGCCACG CCCACCAAAG AGACACCTTC GAAAGGGCCC 
0181 ACCGCAACCC TGGTGCCCAT TGGTTCGCCC AAGACTCCTG TATCAGGAAA GGACACCTGC 
0241 ACTACCCCCA AATCATCTAC TCCTGCCACT GTCAGCGCAT CCGTAGAGGC CAGTAGTTCC 
0301 ACAGGCGAAG CCCTGTCCAA TGGAGATGCC TCAGATAGGT CTTCCACGCC GTCAAAGGGC 
0361 GCTACCACTC CCACCAGCAA GCAAAGCAAT GCAGCAGTGC AGCCACCGAG TAGCACCACT 
0421 CCCAACAGTG TCAGTGGGAA AGAAGAGCCG AAGCTGGCAA CCTGCGGCAG TTTAACGTCC 
0481 GCAACATCAA CTTCAACCAC G 
 Assemble Data

18414R-2.IR_full       1   CCTCGATGATGAATGCTACAGTGGGTCACCTTTCCANCTGCTCCGCCTGTAACTGTTTCT 60
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
18414R-2.in silico     1   CCTCGATGATGAATGCTACAGTGGGTCACCTTTCCA-CTGCTCCGCCTGTAACTGTTTCT 60


18414R-2.IR_full       61  GTGACAAGCACCGCTGTTACTTCGTCGCCGGGTCAGCTGGTTCTCTTAAGCACGGCTAGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18414R-2.in silico     61  GTGACAAGCACCGCTGTTACTTCGTCGCCGGGTCAGCTGGTTCTCTTAAGCACGGCTAGT 120


18414R-2.IR_full       121 AGCGGTGGAGGAGGTAGCATACCAGCCACGCCCACCAAAGAGACACCTTCGAAAGGGCCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18414R-2.in silico     121 AGCGGTGGAGGAGGTAGCATACCAGCCACGCCCACCAAAGAGACACCTTCGAAAGGGCCC 180


18414R-2.IR_full       181 ACCGCAACCCTGGTGCCCATTGGTTCGCCCAAGACTCCTGTATCAGGAAAGGACACCTGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18414R-2.in silico     181 ACCGCAACCCTGGTGCCCATTGGTTCGCCCAAGACTCCTGTATCAGGAAAGGACACCTGC 240


18414R-2.IR_full       241 ACTACCCCCAAATCATCTACTCCTGCCACTGTTAGCGCATCCGTAGAGGCCAGTAGTTCC 300
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
18414R-2.in silico     241 ACTACCCCCAAATCATCTACTCCTGCCACTGTCAGCGCATCCGTAGAGGCCAGTAGTTCC 300


18414R-2.IR_full       301 ACAGGCGAAGCCCTGTCCAATGGAGATGCCTCAGATAGGTCTTCCACGCCGTCAAAGGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18414R-2.in silico     301 ACAGGCGAAGCCCTGTCCAATGGAGATGCCTCAGATAGGTCTTCCACGCCGTCAAAGGGC 360


18414R-2.IR_full       361 GCTACCACTCCCACCAGCAAGCAAAGCAATGCAGCAGTGCAGCCACCGAGTAGCACCACT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18414R-2.in silico     361 GCTACCACTCCCACCAGCAAGCAAAGCAATGCAGCAGTGCAGCCACCGAGTAGCACCACT 420


18414R-2.IR_full       421 CCCAACAGTGTCAGTGGGAAAGAAGAGCCGAAGCTGGCAACCTGCGGCAGTTTAACGTCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18414R-2.in silico     421 CCCAACAGTGTCAGTGGGAAAGAAGAGCCGAAGCTGGCAACCTGCGGCAGTTTAACGTCC 480


18414R-2.IR_full       481 GCAACATCAACTTCAACCACG 501
                           |||||||||||||||||||||
18414R-2.in silico     481 GCAACATCAACTTCAACCACG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057523.3  CG18412-RA (ph-p), mRNA 
49.37   238  112  29  16  NM_080055.2  CG3895-RA (ph-d), mRNA 
0.41   11  NM_139645.2  CG15021-RA (CG15021), mRNA 
0.2   NM_140883.1  CG8780-RA (tey), mRNA 
0   NM_139424.1  CG11814-RA (CG11814), mRNA 
0   NM_206643.1  CG2206-RB, transcript variant B (l(1)G0193), mRNA 
0   NM_080368.2  CG9428-RA (ZIP1), mRNA 
0   NM_132246.2  CG10555-RA (CG10555), mRNA 
0   NM_137009.1  CG4676-RA (CG4676), mRNA 
0   NM_079204.1  CG7525-RA (Tie), mRNA 
0   NM_132914.2  CG9723-RA (CG9723), mRNA 
0   NM_139838.2  CG14830-RA (CG14830), mRNA 
0   12  NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0   NM_143592.1  CG1544-RA, transcript variant A (CG1544), mRNA 
0   NM_170541.2  CG1544-RB, transcript variant B (CG1544), mRNA 
0   NM_166120.1  CG30085-RA (CG30085), mRNA 
0   NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
0   NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
0   NM_142921.2  CG10225-RA (CG10225), mRNA 
0   NM_080141.2  CG10120-RB, transcript variant B (Men), mRNA 
0   NM_169479.1  CG10120-RA, transcript variant A (Men), mRNA 
0   NM_001038732.1  CG12598-RC, transcript variant C (Adar), mRNA 
0   NM_130584.2  CG12598-RA, transcript variant A (Adar), mRNA 
0   NM_166903.1  CG12598-RB, transcript variant B (Adar), mRNA 
0   NM_132367.1  CG15252-RA (CG15252), mRNA 
0   NM_167274.1  CG1938-RD, transcript variant D (Dlic2), mRNA 
0   NM_132466.2  CG1938-RA, transcript variant A (Dlic2), mRNA 
0   NM_167273.1  CG1938-RC, transcript variant C (Dlic2), mRNA 
0   NM_167507.1  CG18734-RB, transcript variant B (Fur2), mRNA 
0   NM_079476.2  CG5683-RB, transcript variant B (Aef1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.