National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18414R-1 
 Symbol ph-p  Full Name polyhomeotic proximal 
 CG No CG18412  Old CG No CG18414 
 Synonyms ph, PH, CG18412, Ph, PH-p, EG:87B1.5, CG18414, php, ph[P], ph-P, phm, ph-p 
 Accession No (Link to NCBI) NM_057523.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Owusu-Ansah E, Banerjee U.
Reactive oxygen species prime Drosophila haematopoietic progenitors for differentiation.
Nature (2009) 461(7263) 537-41 [ PubMed ID = 19727075 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     1   CCTCGATGATGAATGCTACAGTGGGTCACCTTTCCA-CTGCTCCGCCTGTAACTGTTTCT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTGACAAGCACCGCTGTTACTTCGTCGCCGGGTCAGCTGGTTCTCTTAAGCACGGCTAGT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGCGGTGGAGGAGGTAGCATACCAGCCACGCCCACCAAAGAGACACCTTCGAAAGGGCCC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACCGCAACCCTGGTGCCCATTGGTTCGCCCAAGACTCCTGTATCAGGAAAGGACACCTGC 240

                           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     241 ACTACCCCCAAATCATCTACTCCTGCCACTGTCAGCGCATCCGTAGAGGCCAGTAGTTCC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACAGGCGAAGCCCTGTCCAATGGAGATGCCTCAGATAGGTCTTCCACGCCGTCAAAGGGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCTACCACTCCCACCAGCAAGCAAAGCAATGCAGCAGTGCAGCCACCGAGTAGCACCACT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCCAACAGTGTCAGTGGGAAAGAAGAGCCGAAGCTGGCAACCTGCGGCAGTTTAACGTCC 480

18414R-1.IR_full       481 GCAACATCAACTTCAACCACG 501
                           ||||||||||||||||||||| silico     481 GCAACATCAACTTCAACCACG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.