National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18355R-3 
 Symbol Btk29A  Full Name Btk family kinase at 29A 
 CG No CG8049  Old CG No CG18355 
 Synonyms Tec29, CG8049, tec29, Tec, Tec29A, fic, SRC 29A, CT41718, CT2415, DTec29, DSrc28, Dsrc29A, Dsrc28C, Src29A, Dm SRC2, dsrc29A, c-src/fps, src28C, src-4, src4, src2, Src2, S13, CG18355, C-src4, C-src2, Btk29A, Btk family kinase at 29A, Src oncogene 29A, fickle 
 Accession No (Link to NCBI) NM_057397.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCTGATGTCCGAAAGGCTG 
 Primer Seq. 3'
aatctagaggtaccCACAAGCCCGGATGATAGCGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NATCTGATGT CCGAAAgGCT GTACGATGTC GTGAAAAGTG GATCGATGGT GAAAAGGGCT 
0061 CAAAACAAGA AGCGTTTCAC CCCCGTGAAT TACAAACATC GATGGTTTGA GTTGACCAAG 
0121 CGAACTTTCA GCTACTTCGA TGTGGAAAAT GTGGAGCGGA GACgCGAACG TGGTCGCATT 
0181 CATTTGAAGG GCGTTCGCCT GGTGGAGGAG GCGACGGTCA GTGGCGAGGG CGGCGATCCC 
0241 TTTGCACCGG ATGGTTATCC GTTCCAAGTG GGCTACTGTG AGATCTCTGC GTCGGCCAAT 
0301 TCGCATCAGC TGGAGAACGG CAACGGCGgt ggtaGTGGCG TTGGAATCGA GGGTCAGCAG 
0361 AGTGGACGAN CGGTGCCACA GTACACACTC TACGTGNATC GCCAACAGCG AAAAGGAGCG 
0421 CAGCGAGTGG ATCCGCGCCA TCCGCCAAGT TTGTGAGGAT AGTAATACTC CAAAATCGTA 
0481 TCGCTATCAT CCGGGCTTGT G 
 in silico PCR Fragment
0001 GATCTGATGT CCGAAAGGCT GTACGATGTC GTGAAAAGTG GATCGATGGT GAAAAGGGCT 
0061 CAAAACAAGA AGCGTTTCAC CCCCGTGAAT TACAAACATC GATGGTTTGA GTTGACCAAG 
0121 CGAACTTTCA GCTACTTCGA TGTGGAAAAT GTGGAGCGGA GACGCGAACG TGGTCGCATT 
0181 CATTTGAAGG GCGTTCGCCT GGTGGAGGAG GCGACGGTCA GTGGCGAGGG CGGCGATCCC 
0241 TTTGCACCGG ATGGTTATCC GTTCCAAGTG GGCTACTGTG AGATCTCTGC GTCGGCCAAT 
0301 TCGCATCAGC TGGAGAACGG CAACGGCGGT GGTAGTGGCG TTGGAATCGA GGGTCAGCAG 
0361 AGTGGACGAG CGGTGCCACA GTACACACTC TACGTG-ATC GCCAACAGCG AAAAGGAGCG 
0421 CAGCGAGTGG ATCCGCGCCA TCCGCCAAGT TTGTGAGGAT AGTAATACTC CAAAATCGTA 
0481 TCGCTATCAT CCGGGCTTGT G 
 Assemble Data

18355R-3.IR_full        1   ATCTGATGTCCGAAAGGCTGTACGATGTCGTGAAAAGTGGATCGATGGTGAAAAGGGCT 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18355R-3.in silico      1   ATCTGATGTCCGAAAGGCTGTACGATGTCGTGAAAAGTGGATCGATGGTGAAAAGGGCT 59


18355R-3.IR_full       61  CAAAACAAGAAGCGTTTCACCCCCGTGAATTACAAACATCGATGGTTTGAGTTGACCAAG 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18355R-3.in silico     61  CAAAACAAGAAGCGTTTCACCCCCGTGAATTACAAACATCGATGGTTTGAGTTGACCAAG 119


18355R-3.IR_full       121 CGAACTTTCAGCTACTTCGATGTGGAAAATGTGGAGCGGAGACGCGAACGTGGTCGCATT 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18355R-3.in silico     121 CGAACTTTCAGCTACTTCGATGTGGAAAATGTGGAGCGGAGACGCGAACGTGGTCGCATT 179


18355R-3.IR_full       181 CATTTGAAGGGCGTTCGCCTGGTGGAGGAGGCGACGGTCAGTGGCGAGGGCGGCGATCCC 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18355R-3.in silico     181 CATTTGAAGGGCGTTCGCCTGGTGGAGGAGGCGACGGTCAGTGGCGAGGGCGGCGATCCC 239


18355R-3.IR_full       241 TTTGCACCGGATGGTTATCCGTTCCAAGTGGGCTACTGTGAGATCTCTGCGTCGGCCAAT 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18355R-3.in silico     241 TTTGCACCGGATGGTTATCCGTTCCAAGTGGGCTACTGTGAGATCTCTGCGTCGGCCAAT 299


18355R-3.IR_full       301 TCGCATCAGCTGGAGAACGGCAACGGCGGTGGTAGTGGCGTTGGAATCGAGGGTCAGCAG 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18355R-3.in silico     301 TCGCATCAGCTGGAGAACGGCAACGGCGGTGGTAGTGGCGTTGGAATCGAGGGTCAGCAG 359


18355R-3.IR_full       361 AGTGGACGANCGGTGCCACAGTACACACTCTACGTGNATCGCCAACAGCGAAAAGGAGCG 419
                           ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||
18355R-3.in silico     361 AGTGGACGAGCGGTGCCACAGTACACACTCTACGTG-ATCGCCAACAGCGAAAAGGAGCG 419


18355R-3.IR_full       421 CAGCGAGTGGATCCGCGCCATCCGCCAAGTTTGTGAGGATAGTAATACTCCAAAATCGTA 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18355R-3.in silico     421 CAGCGAGTGGATCCGCGCCATCCGCCAAGTTTGTGAGGATAGTAATACTCCAAAATCGTA 479


18355R-3.IR_full       481 TCGCTATCATCCGGGCTTGTG 500
                           |||||||||||||||||||||
18355R-3.in silico     481 TCGCTATCATCCGGGCTTGTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057397.3  CG8049-RB, transcript variant B (Btk29A), mRNA 
100   482  NM_164804.1  CG8049-RD, transcript variant D (Btk29A), mRNA 
0   NM_132950.1  CG13002-RA (CG13002), mRNA 
0   NM_169092.1  CG1109-RB, transcript variant B (CG1109), mRNA 
0   NM_169091.1  CG1109-RA, transcript variant A (CG1109), mRNA 
0   NM_134555.1  CG15454-RA (CG15454), mRNA 
0   NM_132384.2  CG2962-RA (CG2962), mRNA 
0   NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
0   NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
0   NM_079325.2  CG5433-RA (Klc), mRNA 
0   NM_142601.1  CG4845-RA (CG4845), mRNA 
0   NM_133042.1  CG12612-RA (CG12612), mRNA 
0   NM_137192.1  CG12958-RA (CG12958), mRNA 
0   NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   NM_140502.2  CG6888-RA (CG6888), mRNA 
0   NM_168300.1  CG5735-RC, transcript variant C (orb2), mRNA 
0   NM_140009.1  CG5735-RB, transcript variant B (orb2), mRNA 
0   NM_168301.1  CG5735-RD, transcript variant D (orb2), mRNA 
0   NM_136186.1  CG16798-RA (CG16798), mRNA 
0   NM_168302.1  CG5735-RA, transcript variant A (orb2), mRNA 
0   NM_138025.2  CG3121-RA (CG3121), mRNA 
0   NM_001042836.1  CG41105-RA, transcript variant A (CG41105), mRNA 
0   NM_141653.2  CG16789-RA (CG16789), mRNA 
0   NM_078751.3  CG3047-RA (Sgs1), mRNA 
0   16  NM_132976.1  CG5172-RA, transcript variant A (CG5172), mRNA 
0   NM_166876.1  CG14622-RB, transcript variant B (DAAM), mRNA 
0   NM_166875.1  CG14622-RC, transcript variant C (DAAM), mRNA 
0   NM_206140.1  CG8912-RC, transcript variant C (Psi), mRNA 
0   NM_057775.3  CG8912-RB, transcript variant B (Psi), mRNA 
0   NM_166200.2  CG8912-RA, transcript variant A (Psi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.