National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18355R-2 
 Symbol Btk29A  Full Name Btk family kinase at 29A 
 CG No CG8049  Old CG No CG18355 
 Synonyms Tec29, CG8049, tec29, Tec, Tec29A, fic, SRC 29A, CT41718, CT2415, DTec29, DSrc28, Dsrc29A, Dsrc28C, Src29A, Dm SRC2, dsrc29A, c-src/fps, src28C, src-4, src4, src2, Src2, S13, CG18355, C-src4, C-src2, Btk29A, Btk family kinase at 29A, Src oncogene 29A, fickle 
 Accession No (Link to NCBI) NM_057397.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   ATCTGATGTCCGAAAGGCTGTACGATGTCGTGAAAAGTGGATCGATGGTGAAAAGGGCT 59

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAAAACAAGAAGCGTTTCACCCCCGTGAATTACAAACATCGATGGTTTGAGTTGACCAAG 119

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGAACTTTCAGCTACTTCGATGTGGAAAATGTGGAGCGGAGACGCGAACGTGGTCGCATT 179

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CATTTGAAGGGCGTTCGCCTGGTGGAGGAGGCGACGGTCAGTGGCGAGGGCGGCGATCCC 239

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTTGCACCGGATGGTTATCCGTTCCAAGTGGGCTACTGTGAGATCTCTGCGTCGGCCAAT 299

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCGCATCAGCTGGAGAACGGCAACGGCGGTGGTAGTGGCGTTGGAATCGAGGGTCAGCAG 359

                           ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| silico     361 AGTGGACGAGCGGTGCCACAGTACACACTCTACGTG-ATCGCCAACAGCGAAAAGGAGCG 419

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAGCGAGTGGATCCGCGCCATCCGCCAAGTTTGTGAGGATAGTAATACTCCAAAATCGTA 479

18355R-2.IR_full       481 TCGCTATCATCCGGGCTTGTG 500
                           ||||||||||||||||||||| silico     481 TCGCTATCATCCGGGCTTGTG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057397.3  CG8049-RB, transcript variant B (Btk29A), mRNA 
100   482  NM_164804.1  CG8049-RD, transcript variant D (Btk29A), mRNA 
0   NM_132950.1  CG13002-RA (CG13002), mRNA 
0   NM_169092.1  CG1109-RB, transcript variant B (CG1109), mRNA 
0   NM_169091.1  CG1109-RA, transcript variant A (CG1109), mRNA 
0   NM_134555.1  CG15454-RA (CG15454), mRNA 
0   NM_132384.2  CG2962-RA (CG2962), mRNA 
0   NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
0   NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
0   NM_079325.2  CG5433-RA (Klc), mRNA 
0   NM_142601.1  CG4845-RA (CG4845), mRNA 
0   NM_133042.1  CG12612-RA (CG12612), mRNA 
0   NM_137192.1  CG12958-RA (CG12958), mRNA 
0   NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   NM_140502.2  CG6888-RA (CG6888), mRNA 
0   NM_168300.1  CG5735-RC, transcript variant C (orb2), mRNA 
0   NM_140009.1  CG5735-RB, transcript variant B (orb2), mRNA 
0   NM_168301.1  CG5735-RD, transcript variant D (orb2), mRNA 
0   NM_136186.1  CG16798-RA (CG16798), mRNA 
0   NM_168302.1  CG5735-RA, transcript variant A (orb2), mRNA 
0   NM_138025.2  CG3121-RA (CG3121), mRNA 
0   NM_001042836.1  CG41105-RA, transcript variant A (CG41105), mRNA 
0   NM_141653.2  CG16789-RA (CG16789), mRNA 
0   NM_078751.3  CG3047-RA (Sgs1), mRNA 
0   16  NM_132976.1  CG5172-RA, transcript variant A (CG5172), mRNA 
0   NM_166876.1  CG14622-RB, transcript variant B (DAAM), mRNA 
0   NM_166875.1  CG14622-RC, transcript variant C (DAAM), mRNA 
0   NM_206140.1  CG8912-RC, transcript variant C (Psi), mRNA 
0   NM_057775.3  CG8912-RB, transcript variant B (Psi), mRNA 
0   NM_166200.2  CG8912-RA, transcript variant A (Psi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.