National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18340R-1 
 Symbol Ucp4B  Full Name Ucp4B 
 CG No CG18340  Old CG No CG18340 
 Synonyms CG18340, dmUCP4b, DmUCP4B, Ucp4B 
 Accession No (Link to NCBI) NM_135133.1 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGGAAAAGGCGTTAACACAG 
 Primer Seq. 3'
aatctagaggtaccGATCTTAATCAGCTCGGTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGGAAAAGG CGTTAACACA GTCTTTAGGC CAGCAGAATG GGACAATTCG GAGGAGAAGG 
0061 AAAGACCCAA GTTGGAGTAC TTGGTGACCA ACAAGAAGAC TCCGCCGGTT GAACTCTACC 
0121 TCACGGCATT CGcCTCCGCC TGCAGTGCCG AGATTGTGGG CTATCCCTTC GATATGTGCA 
0181 AGACCCGAAT GCAGATCCAG GGCGAGATCG CGAGCAGGGT GGGTCAGAAG GCCAAGTACC 
0241 GAGGTCTGCT GGCTCACTGc CATGGGCATC GTCAGGGAGG AGGGTCTGCT GAAGCTCTAC 
0301 GGTGGCATAT NCCGCCATGC TGTTNCCGCC ACTCGCTCTT CAGTGGCATC AAAATGCTGA 
0361 CCTACGACTA TATGCGTGAG AAGATGATCG TGCCCGACGA GGACGGCAGG CCGCAGCTTA 
0421 TCCNTTCCTG GGATCCTGCA TCAGTGGCGT CTTAGCNGGC GCAACTGCCA GCGTACTAAC 
0481 GAATCCCACC GAGCTGATTA AGATC 
 in silico PCR Fragment
0001 TGGGAAAAGG CGTTAACACA GTCTTTAGGC CAGCAGAATG GGACAATTCG GAGGAGAAGG 
0061 AAAGACCCAA GTTGGAGTAC TTGGTGACCA ACAAGAAGAC TCCGCCGGTT GAACTCTACC 
0121 TCACGGCATT CGCCTCCGCC TGCAGTGCCG AGATTGTGGG CTATCCCTTC GATATGTGCA 
0181 AGACCCGAAT GCAGATCCAG GGCGAGATCG CGAGCAGGGT GGGTCAGAAG GCCAAGTACC 
0241 GAGGTCTGCT GGC-CACTGC CATGGGCATC GTCAGGGAGG AGGGTCTGCT GAAGCTCTAC 
0301 GGTGGCATAT -CCGCCATGC TGTT-CCGCC ACTCGCTCTT CAGTGGCATC AAAATGCTGA 
0361 CCTACGACTA TATGCGTGAG AAGATGATCG TGCCCGACGA GGACGGCAGG CCGCAGC-TA 
0421 TCC-TTCCTG GGATCCTGCA TCAGTGGCGT CTTAGCCGGC GCAACTGCCA GCGTACTAAC 
0481 GAATCCCACC GAGCTGATTA AGATC 
 Assemble Data

18340R-1.IR_full       1   TGGGAAAAGGCGTTAACACAGTCTTTAGGCCAGCAGAATGGGACAATTCGGAGGAGAAGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18340R-1.in silico     1   TGGGAAAAGGCGTTAACACAGTCTTTAGGCCAGCAGAATGGGACAATTCGGAGGAGAAGG 60


18340R-1.IR_full       61  AAAGACCCAAGTTGGAGTACTTGGTGACCAACAAGAAGACTCCGCCGGTTGAACTCTACC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18340R-1.in silico     61  AAAGACCCAAGTTGGAGTACTTGGTGACCAACAAGAAGACTCCGCCGGTTGAACTCTACC 120


18340R-1.IR_full       121 TCACGGCATTCGCCTCCGCCTGCAGTGCCGAGATTGTGGGCTATCCCTTCGATATGTGCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18340R-1.in silico     121 TCACGGCATTCGCCTCCGCCTGCAGTGCCGAGATTGTGGGCTATCCCTTCGATATGTGCA 180


18340R-1.IR_full       181 AGACCCGAATGCAGATCCAGGGCGAGATCGCGAGCAGGGTGGGTCAGAAGGCCAAGTACC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18340R-1.in silico     181 AGACCCGAATGCAGATCCAGGGCGAGATCGCGAGCAGGGTGGGTCAGAAGGCCAAGTACC 240


18340R-1.IR_full       241 GAGGTCTGCTGGCTCACTGCCATGGGCATCGTCAGGGAGGAGGGTCTGCTGAAGCTCTAC 300
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
18340R-1.in silico     241 GAGGTCTGCTGGC-CACTGCCATGGGCATCGTCAGGGAGGAGGGTCTGCTGAAGCTCTAC 300


18340R-1.IR_full       301 GGTGGCATATNCCGCCATGCTGTTNCCGCCACTCGCTCTTCAGTGGCATCAAAATGCTGA 360
                           |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||
18340R-1.in silico     301 GGTGGCATAT-CCGCCATGCTGTT-CCGCCACTCGCTCTTCAGTGGCATCAAAATGCTGA 360


18340R-1.IR_full       361 CCTACGACTATATGCGTGAGAAGATGATCGTGCCCGACGAGGACGGCAGGCCGCAGCTTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
18340R-1.in silico     361 CCTACGACTATATGCGTGAGAAGATGATCGTGCCCGACGAGGACGGCAGGCCGCAGC-TA 420


18340R-1.IR_full       421 TCCNTTCCTGGGATCCTGCATCAGTGGCGTCTTAGCNGGCGCAACTGCCAGCGTACTAAC 480
                           ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||
18340R-1.in silico     421 TCC-TTCCTGGGATCCTGCATCAGTGGCGTCTTAGCCGGCGCAACTGCCAGCGTACTAAC 480


18340R-1.IR_full       481 GAATCCCACCGAGCTGATTAAGATC 505
                           |||||||||||||||||||||||||
18340R-1.in silico     481 GAATCCCACCGAGCTGATTAAGATC 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135133.1  CG18340-RA, transcript variant A (Ucp4B), mRNA 
100   482  NM_164666.1  CG18340-RB, transcript variant B (Ucp4B), mRNA 
0   NM_169362.1  CG6544-RB, transcript variant B (fau), mRNA 
0   NM_057464.3  CG5779-RA (Bc), mRNA 
0   NM_165479.1  CG15845-RA, transcript variant A (Adf1), mRNA 
0   NM_206028.1  CG15845-RC, transcript variant C (Adf1), mRNA 
0   NM_165480.1  CG15845-RB, transcript variant B (Adf1), mRNA 
0   NM_139667.2  CG18418-RA (CG18418), mRNA 
0   NM_141384.2  CG15188-RA (Osi20), mRNA 
0   12  12  NM_134697.1  CG12506-RA (CG12506), mRNA 
0   NM_166667.1  CG3411-RA (bs), mRNA 
0   NM_166056.1  CG10110-RB, transcript variant B (cpsf), mRNA 
0   NM_206111.1  CG10110-RA, transcript variant A (cpsf), mRNA 
0   NM_144367.1  CG6633-RA (Ugt86Dd), mRNA 
0   NM_143344.2  CG5520-RA (Gp93), mRNA 
0   NM_137156.2  CG10242-RA (Cyp6a23), mRNA 
0   NM_140155.2  CG7958-RA, transcript variant A (tna), mRNA 
0   NM_168422.1  CG7958-RB, transcript variant B (tna), mRNA 
0   NM_169845.1  CG31043-RA, transcript variant A (gukh), mRNA 
0   NM_132513.4  CG2446-RC, transcript variant C (CG2446), mRNA 
0   NM_167299.1  CG2446-RB, transcript variant B (CG2446), mRNA 
0   NM_167300.1  CG2446-RD, transcript variant D (CG2446), mRNA 
0   NM_167301.1  CG2446-RE, transcript variant E (CG2446), mRNA 
0   NM_167298.1  CG2446-RA, transcript variant A (CG2446), mRNA 
0   NM_142643.1  CG15923-RA (CG15923), mRNA 
0   NM_137632.3  CG8929-RA, transcript variant A (CG8929), mRNA 
0   NM_166389.1  CG8929-RB, transcript variant B (CG8929), mRNA 
0   NM_166390.1  CG8929-RC, transcript variant C (CG8929), mRNA 
0   NM_135426.2  CG9582-RA (CG9582), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.