National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18316R-2 
 Symbol CG18316  Full Name CG18316 
 CG No CG18316  Old CG No CG18316 
 Synonyms CG18316 
 Accession No (Link to NCBI) NM_136509.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| silico     1   CAAAAGATGAGAAGCCATCGCCTTTGAAAA-CTGCACCGCGTAAAATAAAGGGTGAGAAT 60

                           |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTTCCAGCCAGA-AGGATACCCGCAAATGTTTTGAAACGCACGCTTGAGATCGCCACCAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCCCGAAGATGGCTTTTGGGTGAACCAAAACCCATCCTGTGCTCCTCCGGCCAGTAACGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTTTTACTTCAGCGTTCGACGATCCACTGCGTACGAGAAACTACGACTGGCCCGGGATTG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCTTATGCAGCGGGACTACAAGAACTTGGCAAAAATACTGGCCTCCAATCATATGGGAGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACGCTGCTCCAAAGGGCGTCCTTTCAAATATTCACGGAATACTCCAAGGTTCTTCAAAA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTGCCCAAAGTTCTACACGAAAATGGAGCAGTTGCGAGTGGAGCCGACTCCTCCGACGAG 420

                           |||||||||||||||||||||||||||||||||| silico     421 ACCCACAGATGAAGACATAGCATTAGACGATTCA 454

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   434  NM_136509.2  CG18316-RA (CG18316), mRNA 
0   NM_167474.1  CG8909-RB (CG8909), mRNA 
0   NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0   NM_001038916.1  CG17689-RB, transcript variant B (CG17689), mRNA 
0   NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_142570.2  CG7535-RA, transcript variant A (GluClalpha), mRNA 
0   NM_169873.1  CG7535-RB, transcript variant B (GluClalpha), mRNA 
0   NM_001014641.1  CG7535-RC, transcript variant C (GluClalpha), mRNA 
0   NM_001038972.1  CG7535-RD, transcript variant D (GluClalpha), mRNA 
0   NM_169510.1  CG8790-RB, transcript variant B (CG8790), mRNA 
0   NM_142022.2  CG8790-RA, transcript variant A (CG8790), mRNA 
0   NM_139515.3  CG1291-RA (CG1291), mRNA 
0   NM_134689.1  CG2794-RA (CG2794), mRNA 
0   NM_001031910.1  CG11566-RA (CG11566), mRNA 
0   NM_001031911.1  CG33670-RA (CG33670), mRNA 
0   NM_132561.1  CG15733-RA (CG15733), mRNA 
0   NM_137972.2  CG5431-RA (CG5431), mRNA 
0   NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0   NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0   NM_079055.2  CG4943-RA (lack), mRNA 
0   NM_176133.3  CG12052-RI, transcript variant I (lola), mRNA 
0   NR_002001.1  CR18748, mRNA 
0   NM_176176.1  CG8183-RB, transcript variant B (Khc-73), mRNA 
0   NM_135357.3  CG8183-RA, transcript variant A (Khc-73), mRNA 
0   NM_138185.2  CG17084-RA (mthl9), mRNA 
0   NM_138163.1  CG7036-RA, transcript variant A (rno), mRNA 
0   NM_206222.1  CG7036-RB, transcript variant B (rno), mRNA 
0   NM_140693.1  CG7842-RA (CG7842), mRNA 
0   NM_168252.1  CG7892-RB, transcript variant B (nmo), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.