National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18316R-1 
 Symbol CG18316  Full Name CG18316 
 CG No CG18316  Old CG No CG18316 
 Synonyms CG18316 
 Accession No (Link to NCBI) NM_136509.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAAAGATGAGAAGCCATCGC 
 Primer Seq. 3'
aatctagaggtaccTGAATCGTCTAATGCTATGTC 
 Predicted Fragment Size
452 
 IR fragment full Seq
0001 CAAAAGATGA GAAGCCATCG CCTTTGAAAA NCTGCACCGC GTAAAATAAA GGGTGAGAAT 
0061 TTTCCAGCCA GANAGGATAC CCGCAAATGT TTTGAAACGC ACGCTTGAGA TCGCCACCAG 
0121 TCCCGAAGAT GGCTTTTGGG TGAACCAAAA CCCATCCTGT GCTCCTCCGG CCAGTAACGA 
0181 GTTTTACTTC AGCGTTCGAC GATCCACTGC GTACGAGAAA CTACGACTGG CCCGGGATTG 
0241 CCTTATGCAG CGGGACTACA AGAACTTGGC AAAAATACTG GCCTCCAATC ATATGGGAGA 
0301 AACGCTGCTC CAAAGGGCGT CCTTTCAAAT ATTCACGGAA TACTCCAAGG TTCTTCAAAA 
0361 GTGCCCAAAG TTCTACACGA AAATGGAGCA GTTGCGAGTG GAGCCGACTC CTCCGACGAG 
0421 ACCCACAGAT GAAGACATAG CATTAGACGA TTCA 
 in silico PCR Fragment
0001 CAAAAGATGA GAAGCCATCG CCTTTGAAAA -CTGCACCGC GTAAAATAAA GGGTGAGAAT 
0061 TTTCCAGCCA GA-AGGATAC CCGCAAATGT TTTGAAACGC ACGCTTGAGA TCGCCACCAG 
0121 TCCCGAAGAT GGCTTTTGGG TGAACCAAAA CCCATCCTGT GCTCCTCCGG CCAGTAACGA 
0181 GTTTTACTTC AGCGTTCGAC GATCCACTGC GTACGAGAAA CTACGACTGG CCCGGGATTG 
0241 CCTTATGCAG CGGGACTACA AGAACTTGGC AAAAATACTG GCCTCCAATC ATATGGGAGA 
0301 AACGCTGCTC CAAAGGGCGT CCTTTCAAAT ATTCACGGAA TACTCCAAGG TTCTTCAAAA 
0361 GTGCCCAAAG TTCTACACGA AAATGGAGCA GTTGCGAGTG GAGCCGACTC CTCCGACGAG 
0421 ACCCACAGAT GAAGACATAG CATTAGACGA TTCA 
 Assemble Data

18316R-1.IR_full       1   CAAAAGATGAGAAGCCATCGCCTTTGAAAANCTGCACCGCGTAAAATAAAGGGTGAGAAT 60
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
18316R-1.in silico     1   CAAAAGATGAGAAGCCATCGCCTTTGAAAA-CTGCACCGCGTAAAATAAAGGGTGAGAAT 60


18316R-1.IR_full       61  TTTCCAGCCAGANAGGATACCCGCAAATGTTTTGAAACGCACGCTTGAGATCGCCACCAG 120
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
18316R-1.in silico     61  TTTCCAGCCAGA-AGGATACCCGCAAATGTTTTGAAACGCACGCTTGAGATCGCCACCAG 120


18316R-1.IR_full       121 TCCCGAAGATGGCTTTTGGGTGAACCAAAACCCATCCTGTGCTCCTCCGGCCAGTAACGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18316R-1.in silico     121 TCCCGAAGATGGCTTTTGGGTGAACCAAAACCCATCCTGTGCTCCTCCGGCCAGTAACGA 180


18316R-1.IR_full       181 GTTTTACTTCAGCGTTCGACGATCCACTGCGTACGAGAAACTACGACTGGCCCGGGATTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18316R-1.in silico     181 GTTTTACTTCAGCGTTCGACGATCCACTGCGTACGAGAAACTACGACTGGCCCGGGATTG 240


18316R-1.IR_full       241 CCTTATGCAGCGGGACTACAAGAACTTGGCAAAAATACTGGCCTCCAATCATATGGGAGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18316R-1.in silico     241 CCTTATGCAGCGGGACTACAAGAACTTGGCAAAAATACTGGCCTCCAATCATATGGGAGA 300


18316R-1.IR_full       301 AACGCTGCTCCAAAGGGCGTCCTTTCAAATATTCACGGAATACTCCAAGGTTCTTCAAAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18316R-1.in silico     301 AACGCTGCTCCAAAGGGCGTCCTTTCAAATATTCACGGAATACTCCAAGGTTCTTCAAAA 360


18316R-1.IR_full       361 GTGCCCAAAGTTCTACACGAAAATGGAGCAGTTGCGAGTGGAGCCGACTCCTCCGACGAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18316R-1.in silico     361 GTGCCCAAAGTTCTACACGAAAATGGAGCAGTTGCGAGTGGAGCCGACTCCTCCGACGAG 420


18316R-1.IR_full       421 ACCCACAGATGAAGACATAGCATTAGACGATTCA 454
                           ||||||||||||||||||||||||||||||||||
18316R-1.in silico     421 ACCCACAGATGAAGACATAGCATTAGACGATTCA 454

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   434  NM_136509.2  CG18316-RA (CG18316), mRNA 
0   NM_167474.1  CG8909-RB (CG8909), mRNA 
0   NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0   NM_001038916.1  CG17689-RB, transcript variant B (CG17689), mRNA 
0   NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_142570.2  CG7535-RA, transcript variant A (GluClalpha), mRNA 
0   NM_169873.1  CG7535-RB, transcript variant B (GluClalpha), mRNA 
0   NM_001014641.1  CG7535-RC, transcript variant C (GluClalpha), mRNA 
0   NM_001038972.1  CG7535-RD, transcript variant D (GluClalpha), mRNA 
0   NM_169510.1  CG8790-RB, transcript variant B (CG8790), mRNA 
0   NM_142022.2  CG8790-RA, transcript variant A (CG8790), mRNA 
0   NM_139515.3  CG1291-RA (CG1291), mRNA 
0   NM_134689.1  CG2794-RA (CG2794), mRNA 
0   NM_001031910.1  CG11566-RA (CG11566), mRNA 
0   NM_001031911.1  CG33670-RA (CG33670), mRNA 
0   NM_132561.1  CG15733-RA (CG15733), mRNA 
0   NM_137972.2  CG5431-RA (CG5431), mRNA 
0   NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0   NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0   NM_079055.2  CG4943-RA (lack), mRNA 
0   NM_176133.3  CG12052-RI, transcript variant I (lola), mRNA 
0   NR_002001.1  CR18748, mRNA 
0   NM_176176.1  CG8183-RB, transcript variant B (Khc-73), mRNA 
0   NM_135357.3  CG8183-RA, transcript variant A (Khc-73), mRNA 
0   NM_138185.2  CG17084-RA (mthl9), mRNA 
0   NM_138163.1  CG7036-RA, transcript variant A (rno), mRNA 
0   NM_206222.1  CG7036-RB, transcript variant B (rno), mRNA 
0   NM_140693.1  CG7842-RA (CG7842), mRNA 
0   NM_168252.1  CG7892-RB, transcript variant B (nmo), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.