National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18290R-2 
 Symbol Act87E  Full Name Actin 87E 
 CG No CG18290  Old CG No CG18290 
 Synonyms CG18290, Actin, actin, E, mus87E, act 87E, act87E, Act87E 
 Accession No (Link to NCBI) NM_057743.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     1   GGTTGCCGCATTGGTCGTGGACAATGGTTCCGGAATGTGCAAGGCAGGATTCGCCGGCGA 60

                           ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGATG-CGCCCCGCGCCGTCTTCCCCTCGATTGTGGGTCGTCCCCGTCATCAGGGCGTAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGGTGGGCATGGGACAGAAGGACTCCTATGTTGGTGATGAGGCCCAGAGCAAGCGTGGTA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCCTCACCCTGAAATACCCCATCGAGCACGGCATCATCACCAACTGGGACGATATGGAGA 240

                           ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     241 AGATCTGGCACCACACTTTCTATAACGAGCTGCGCGT-CGCCCCCGAGGAACACCCCGTC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAATCGCGAGAAGATGACCCAGATCATG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTCGAGACCTTCAACGCACCCGCCATGTATGTGGCCATCCAGGCTGTGCTCTCGCTGTAC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCCTCCGGTCGTACCACCGGTATTGTCCTCGACTCCGGTGACGGTGTCTCCCACACCGTG 480

18290R-2.IR_full       481 CCCATCTACGAGGGTTACGCCC 502
                           |||||||||||||||||||||| silico     481 CCCATCTACGAGGGTTACGCCC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057743.3  CG18290-RA, transcript variant A (Act87E), mRNA 
100   482  NM_169525.1  CG18290-RB, transcript variant B (Act87E), mRNA 
23.85   115  112  98  93  NM_078497.2  CG4027-RB, transcript variant B (Act5C), mRNA 
23.85   115  112  98  93  NM_167053.1  CG4027-RA, transcript variant A (Act5C), mRNA 
23.85   115  112  98  93  NM_001014725.1  CG4027-RD, transcript variant D (Act5C), mRNA 
23.85   115  112  98  93  NM_001014726.1  CG4027-RC, transcript variant C (Act5C), mRNA 
14.31   69  93  107  100  NM_079643.1  CG5178-RA (Act88F), mRNA 
11.61   56  126  143  107  NM_079076.3  CG10067-RA, transcript variant A (Act57B), mRNA 
11.61   56  126  134  106  NM_166414.1  CG10067-RB, transcript variant B (Act57B), mRNA 
7.05   34  103  190  92  NM_079486.3  CG7478-RA (Act79B), mRNA 
0   60  122  126  NM_078901.2  CG12051-RA (Act42A), mRNA 
0   11  13  39  NM_079607.2  CG6174-RA (Arp87C), mRNA 
0   NM_132678.2  CG2691-RA (CG2691), mRNA 
0   NM_165847.1  CG8996-RA, transcript variant A (wal), mRNA 
0   NM_057627.3  CG8996-RB, transcript variant B (wal), mRNA 
0   16  51  NM_057689.1  CG5409-RA (Arp53D), mRNA 
0   NM_001015160.1  CG12449-PC.3 (CG12449), mRNA 
0   NM_001015161.1  CG12449-PE.3 (CG12449), mRNA 
0   NM_001015157.1  CG12449-PA.3 (CG12449), mRNA 
0   NM_001015158.1  CG12449-PD.3 (CG12449), mRNA 
0   NM_001015162.1  CG12449-PF.3 (CG12449), mRNA 
0   NM_001015159.1  CG12449-PB.3 (CG12449), mRNA 
0   NM_140737.1  CG6298-RA (Jon74E), mRNA 
0   NM_143059.1  CG13646-RA (CG13646), mRNA 
0   NM_079677.2  CG6027-RA (cdi), mRNA 
0   NM_057280.3  CG8695-RA (LvpL), mRNA 
0   NM_164443.1  CG31665-RA, transcript variant A (CG31665), mRNA 
0   NM_205889.1  CG31665-RB, transcript variant B (CG31665), mRNA 
0   NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.