National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1819R-1 
 Symbol CG34120  Full Name CG34120 
 CG No CG34120  Old CG No CG1819 
 Synonyms CG1819, BcDNA:AT04622, CG32516, CG34120 
 Accession No (Link to NCBI) NM_001042822.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTGAGGCTGTGGAAAGTGTG 
 Primer Seq. 3'
aatctagaggtaccCCATCCAAGGATGATGGAGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTGAGGCTG TGGAAAGTGT GGAGGAACTG CACAAGAGAG CCTACGAACT AAATCAAAAC 
0061 AAGTTGTTTT TGGCCGCCCT CAATCTGGAG GACGTAGGTC TCAAGCAAGC GTCCTACCGT 
0121 CTGCATATGG ATACGGATAA CACGCAGCCG ACTTTTGAGA ACCGGAACAG ATTCTGGTTC 
0181 CCCGGACCCG CCGACAGCAT GGTTATTGAT CTGAAGTATC ATCGTGGCTT CGTTCAGCTC 
0241 AAACAGATGG TCGACCTGGG AATTATCAAA AGCAAGCGAG AAGAGGCTGG CTTTGCGCCA 
0301 GAGGAGGATG GGCCTGAAAG TGGGCGTTCC TTAAGTGGTC TTTTTAGTAT CAAGCAGGTG 
0361 GAGAACGATA CGCCCGATGA GGATGATGAT GACTTTGATC TCAGTCTGGA GGAAAGCGGT 
0421 GACGAGAAGG CCGCTCCAAA GGTATCAGCA TCTGCGAGTG ATCATGAGGC AACAACCATT 
0481 TCTCCATCAT CCTTGGATGG  
 in silico PCR Fragment
0001 TTTGAGGCTG TGGAAAGTGT GGAGGAACTG CACAAGAGAG CCTACGAACT AAATCAAAAC 
0061 AAGTTGTTTT TGGCCGCCCT CAATCTGGAG GACGTAGGTC TCAAGCAAGC GTCCTACCGT 
0121 CTGCATATGG ATACGGATAA CACGCAGCCG ACTTTTGAGA ACCGGAACAG ATTCTGGTTC 
0181 CCCGGACCCG CCGACAGCAT GGTTATTGAT CTGAAGTATC ATCGTGGCTT CGTTCAGCTC 
0241 AAACAGATGG TCGACCTGGG AATTATCAAA AGCAAGCGAG AAGAGGCTGG CTTTGCGCCA 
0301 GAGGAGGATG GGCCTGAAAG TGGGCGTTCC TTAAGTGGTC TTTTTAGTAT CAAGCAGGTG 
0361 GAGAACGATA CGCCCGATGA GGATGATGAT GACTTTGATC TCAGTCTGGA GGAAAGCGGT 
0421 GACGAGAAGG CCGCTCCAAA GGTATCAGCA TCTGCGAGTG ATCATGAGGC AACAACCATT 
0481 TCTCCATCAT CCTTGGATGG  
 Assemble Data

1819R-1.IR_full       1   TTTGAGGCTGTGGAAAGTGTGGAGGAACTGCACAAGAGAGCCTACGAACTAAATCAAAAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1819R-1.in silico     1   TTTGAGGCTGTGGAAAGTGTGGAGGAACTGCACAAGAGAGCCTACGAACTAAATCAAAAC 60


1819R-1.IR_full       61  AAGTTGTTTTTGGCCGCCCTCAATCTGGAGGACGTAGGTCTCAAGCAAGCGTCCTACCGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1819R-1.in silico     61  AAGTTGTTTTTGGCCGCCCTCAATCTGGAGGACGTAGGTCTCAAGCAAGCGTCCTACCGT 120


1819R-1.IR_full       121 CTGCATATGGATACGGATAACACGCAGCCGACTTTTGAGAACCGGAACAGATTCTGGTTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1819R-1.in silico     121 CTGCATATGGATACGGATAACACGCAGCCGACTTTTGAGAACCGGAACAGATTCTGGTTC 180


1819R-1.IR_full       181 CCCGGACCCGCCGACAGCATGGTTATTGATCTGAAGTATCATCGTGGCTTCGTTCAGCTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1819R-1.in silico     181 CCCGGACCCGCCGACAGCATGGTTATTGATCTGAAGTATCATCGTGGCTTCGTTCAGCTC 240


1819R-1.IR_full       241 AAACAGATGGTCGACCTGGGAATTATCAAAAGCAAGCGAGAAGAGGCTGGCTTTGCGCCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1819R-1.in silico     241 AAACAGATGGTCGACCTGGGAATTATCAAAAGCAAGCGAGAAGAGGCTGGCTTTGCGCCA 300


1819R-1.IR_full       301 GAGGAGGATGGGCCTGAAAGTGGGCGTTCCTTAAGTGGTCTTTTTAGTATCAAGCAGGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1819R-1.in silico     301 GAGGAGGATGGGCCTGAAAGTGGGCGTTCCTTAAGTGGTCTTTTTAGTATCAAGCAGGTG 360


1819R-1.IR_full       361 GAGAACGATACGCCCGATGAGGATGATGATGACTTTGATCTCAGTCTGGAGGAAAGCGGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1819R-1.in silico     361 GAGAACGATACGCCCGATGAGGATGATGATGACTTTGATCTCAGTCTGGAGGAAAGCGGT 420


1819R-1.IR_full       421 GACGAGAAGGCCGCTCCAAAGGTATCAGCATCTGCGAGTGATCATGAGGCAACAACCATT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1819R-1.in silico     421 GACGAGAAGGCCGCTCCAAAGGTATCAGCATCTGCGAGTGATCATGAGGCAACAACCATT 480


1819R-1.IR_full       481 TCTCCATCATCCTTGGATGG 500
                          ||||||||||||||||||||
1819R-1.in silico     481 TCTCCATCATCCTTGGATGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001042822.1  CG34120-RC, transcript variant C (CG34120), mRNA 
0.2   NM_140928.2  CG32223-RA (CG32223), mRNA 
0.2   NM_143601.2  CG12114-RA (CG12114), mRNA 
0.2   NM_170278.1  CG31082-RA (CG31082), mRNA 
0   NM_001032402.1  CG33957-RB, transcript variant B (cp309), mRNA 
0   NM_138111.2  CG4806-RA (CG4806), mRNA 
0   NM_169740.1  CG5201-RB, transcript variant B (Dad), mRNA 
0   NM_001014629.1  CG5201-RC, transcript variant C (Dad), mRNA 
0   NM_057912.3  CG5201-RA, transcript variant A (Dad), mRNA 
0   25  NM_168401.1  CG6611-RC, transcript variant C (ect), mRNA 
0   22  NM_168400.1  CG6611-RB, transcript variant B (ect), mRNA 
0   22  NM_079967.4  CG6611-RA, transcript variant A (ect), mRNA 
0   NM_135453.1  CG13114-RA (CG13114), mRNA 
0   NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
0   NM_057357.2  CG1569-RA (rod), mRNA 
0   NM_079693.2  CG4173-RA (Sep2), mRNA 
0   NM_057299.3  CG13399-RA, transcript variant A (Chrac-14), mRNA 
0   NM_001032060.1  CG10890-RB, transcript variant B (mus201), mRNA 
0   NM_001032061.1  CG10890-RA, transcript variant A (mus201), mRNA 
0   NM_001032059.1  CG10890-RC, transcript variant C (mus201), mRNA 
0   NM_136862.1  CG8271-RA (CG8271), mRNA 
0   NM_168316.1  CG4821-RB, transcript variant B (Tequila), mRNA 
0   NM_168314.1  CG4821-RD, transcript variant D (Tequila), mRNA 
0   NM_141029.1  CG12976-RA (CG12976), mRNA 
0   NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
0   NM_168080.1  CG32251-RA (CG32251), mRNA 
0   NM_132529.2  CG2025-RA (CG2025), mRNA 
0   NM_138040.2  CG3231-RA (CG3231), mRNA 
0   11  NM_176229.1  CG33147-RA (CG33147), mRNA 
0   NM_141765.1  CG4655-RA, transcript variant A (CG4655), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.