National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18180R-2 
 Symbol CG18180  Full Name CG18180 
 CG No CG18180  Old CG No CG18180 
 Synonyms SP151, CG18180 
 Accession No (Link to NCBI) NM_140084.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATTGCCAACGACTGGATCCTG 
 Primer Seq. 3'
aatctagaggtaccACGGAGGCAAAGGTGATCACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATTGCCAACG ACTGGATCCT GACTGCCGCC CATTGCTTGA CCGGAGACTA CGTGGAGATC 
0061 CACTACGGAT CCAACTGGGG CTGGAACGGT GCCTACAGGC AGACCGTCCG TCGCGACAAC 
0121 TTCATTAGCC ACCCCGACTG GCCTTCCCAG GGCGGCCGAG ACATTGGTCT GATCCGCACT 
0181 CCCCATGTCG ACTTCAACGG ACTGATCAAC AAGATCCCTC TGCCAAGCAT GAACGAGCAG 
0241 AACGACCGCT ACCAGGACAC CTGGTGCGTC GCTNTGCGGA TGGGGCGGTA TGGACAACGG 
0301 AAACCTGGCC GACTGGCTGC AGTGCGTCGA TGTCCAGATC ATCAGCAACA GCGAGTGCGA 
0361 GCAGGNCTAT GGCTCGGNTT GCCAGTACCG ACATGTGCAN CCGTCACGCC GACGGAAAGT 
0421 CCGTGTGCGG AGGTGACTCC GGTGGCCCCC TGGTTACACA CGACAATGCT CGTCTCGTCG 
0481 GTGTGATCAC CTTTGCCTCC GT 
 in silico PCR Fragment
0001 ATTGCCAACG ACTGGATCCT GACTGCCGCC CATTGCTTGA CCGGAGACTA CGTGGAGATC 
0061 CACTACGGAT CCAACTGGGG CTGGAACGGT GCCTACAGGC AGACCGTCCG TCGCGACAAC 
0121 TTCATTAGCC ACCCCGACTG GCCTTCCCAG GGCGGCCGAG ACATTGGTCT GATCCGCACT 
0181 CCCCATGTCG ACTTCAACGG ACTGATCAAC AAGATCCCTC TGCCAAGCAT GAACGAGCAG 
0241 AACGACCGCT ACCAGGACAC CTGGTGCGTC GCT-TGCGGA TGGGGTGGTA TGGACAACGG 
0301 AAACCTGGCC GACTGGCTGC AGTGCGTCGA TGTCCAGATC ATCAGCAACA GCGAGTGCGA 
0361 GCAGGCCTAC GGCTCGG-TT GCCAGTACCG ACATGTGCAC CCGTCACGCC GACGGAAAGT 
0421 CCGTGTGCGG AGGTGACTCC GGTGGCCCCC TGGTTACACA CGACAATGCT CGTCTCGTCG 
0481 GTGTGATCAC CTTTGCCTCC GT 
 Assemble Data

18180R-2.IR_full       1   ATTGCCAACGACTGGATCCTGACTGCCGCCCATTGCTTGACCGGAGACTACGTGGAGATC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18180R-2.in silico     1   ATTGCCAACGACTGGATCCTGACTGCCGCCCATTGCTTGACCGGAGACTACGTGGAGATC 60


18180R-2.IR_full       61  CACTACGGATCCAACTGGGGCTGGAACGGTGCCTACAGGCAGACCGTCCGTCGCGACAAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18180R-2.in silico     61  CACTACGGATCCAACTGGGGCTGGAACGGTGCCTACAGGCAGACCGTCCGTCGCGACAAC 120


18180R-2.IR_full       121 TTCATTAGCCACCCCGACTGGCCTTCCCAGGGCGGCCGAGACATTGGTCTGATCCGCACT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18180R-2.in silico     121 TTCATTAGCCACCCCGACTGGCCTTCCCAGGGCGGCCGAGACATTGGTCTGATCCGCACT 180


18180R-2.IR_full       181 CCCCATGTCGACTTCAACGGACTGATCAACAAGATCCCTCTGCCAAGCATGAACGAGCAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18180R-2.in silico     181 CCCCATGTCGACTTCAACGGACTGATCAACAAGATCCCTCTGCCAAGCATGAACGAGCAG 240


18180R-2.IR_full       241 AACGACCGCTACCAGGACACCTGGTGCGTCGCTNTGCGGATGGGGCGGTATGGACAACGG 300
                           ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||
18180R-2.in silico     241 AACGACCGCTACCAGGACACCTGGTGCGTCGCT-TGCGGATGGGGTGGTATGGACAACGG 300


18180R-2.IR_full       301 AAACCTGGCCGACTGGCTGCAGTGCGTCGATGTCCAGATCATCAGCAACAGCGAGTGCGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18180R-2.in silico     301 AAACCTGGCCGACTGGCTGCAGTGCGTCGATGTCCAGATCATCAGCAACAGCGAGTGCGA 360


18180R-2.IR_full       361 GCAGGNCTATGGCTCGGNTTGCCAGTACCGACATGTGCANCCGTCACGCCGACGGAAAGT 420
                           ||||| ||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||
18180R-2.in silico     361 GCAGGCCTACGGCTCGG-TTGCCAGTACCGACATGTGCACCCGTCACGCCGACGGAAAGT 420


18180R-2.IR_full       421 CCGTGTGCGGAGGTGACTCCGGTGGCCCCCTGGTTACACACGACAATGCTCGTCTCGTCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18180R-2.in silico     421 CCGTGTGCGGAGGTGACTCCGGTGGCCCCCTGGTTACACACGACAATGCTCGTCTCGTCG 480


18180R-2.IR_full       481 GTGTGATCACCTTTGCCTCCGT 502
                           ||||||||||||||||||||||
18180R-2.in silico     481 GTGTGATCACCTTTGCCTCCGT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140084.1  CG18180-RA (CG18180), mRNA 
5.8   28  47  42  106  NM_140083.1  CG18179-RA (CG18179), mRNA 
1.65   19  22  41  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
1.24   16  31  14  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
1.24   16  26  16  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
1.24   46  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
1.24   46  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0.41   13  21  36  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0.41   13  21  27  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   NM_134674.1  CG11911-RA (CG11911), mRNA 
0   19  29  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
0   11  NM_080165.1  CG18211-RA (betaTry), mRNA 
0   NM_165823.1  CG30028-RA (gammaTry), mRNA 
0   NM_165825.1  CG30025-RA (CG30025), mRNA 
0   NM_165824.1  CG30031-RA (CG30031), mRNA 
0   NM_057423.3  CG18444-RA (alphaTry), mRNA 
0   NM_078970.3  CG12351-RA (deltaTry), mRNA 
0   16  18  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0   15  18  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0   16  48  NM_140082.1  CG8329-RA (CG8329), mRNA 
0   10  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0   NM_136830.4  CG12388-RA (kappaTry), mRNA 
0   10  NM_080373.2  CG18681-RA (epsilonTry), mRNA 
0   11  NM_136265.2  CG17571-RA (CG17571), mRNA 
0   NM_141316.1  CG1347-RA, transcript variant A (CG1347), mRNA 
0   NM_206434.1  CG1347-RB, transcript variant B (CG1347), mRNA 
0   15  NM_132302.3  CG7055-RA (dalao), mRNA 
0   NM_144047.1  CG18679-RA (CG18679), mRNA 
0   NM_080180.2  CG10988-RA (l(1)dd4), mRNA 
0   NM_168827.1  CG32219-RA (CG32219), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.