National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18179R-2 
 Symbol CG18179  Full Name CG18179 
 CG No CG18179  Old CG No CG18179 
 Synonyms SP152, BEST:LP02275, CG18179 
 Accession No (Link to NCBI) NM_140083.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAGGTGACCATTTCCGAGGG 
 Primer Seq. 3'
aatctagaggtaccGCTCGCACTCGCTGTTGCTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAGGTGACC ATTTCCGAGG GTGCCGAGGG CCGCATCGTC AACGGTTACC CAGCGCCCGA 
0061 GGGAAAGGCT CCCTACATTG TGGGACTGTT GATCCGCACT GATGGAAGCA ACAGTGCCGC 
0121 GGTTGGAGCT GGAACCATCA TCGCCAGCGA CTGGATTCTG ACCGCCGCTC ACTGTCTGAC 
0181 CACCGACTAC GTGGAGATCC ACTATGGATC CAACTGGGGC TGGAACGGAG CTTTCAGGCA 
0241 ATCTGTCCGC CGTGACAACT TTATCAGCCA TCCAAACTGG CCCGCTGAGG GCGGTCGNTG 
0301 ACATCGGTCT GATCCGCACT NCCCTCCGTG GGCTTCACCG ACTTGATCAA CAAGGTCGCC 
0361 CTGCCAAGCT TCAGCGAGGA GAGCGACCGC TTTGTGGACA CCTGGTGCGT TGCCTGCGGA 
0421 TGGGGCGGCA TGGACAATGG CAACCTGGCC GACTGGCTGC AGTGCATGGA CGTCCAGATC 
0481 ATCAGCAACA GCGAGTGCGA GC 
 in silico PCR Fragment
0001 CCAGGTGACC ATTTCCGAGG GTGCCGAGGG CCGCATCGTC AACGGTTACC CAGCGCCCGA 
0061 GGGAAAGGCT CCCTACATTG TGGGACTGTT GATCCGCACC GATGGAAGCA ACAGTGCCGC 
0121 GGTTGGAGCT GGAACCATCA TCGCCAGCGA CTGGATTCTG ACCGCCGCTC ACTGTCTGAC 
0181 CACCGACTAC GTGGAGATCC ACTATGGATC CAACTGGGGC TGGAACGGAG CTTTCAGGCA 
0241 ATCTGTCCGC CGTGACAACT TTATCAGCCA TCCAAACTGG CCCGCTGAGG GCGGTCG-TG 
0301 ACATCGGTCT GATCCGCACT -CCCTCCGTG GGCTTCACCG ACTTGATCAA CAAGGTCGCC 
0361 CTGCCAAGCT TCAGCGAGGA GAGCGACCGC TTCGTGGACA CATGGTGCGT TGCCTGCGGA 
0421 TGGGGCGGCA TGGACAATGG CAACCTGGCC GACTGGCTGC AGTGCATGGA CGTCCAGATC 
0481 ATCAGCAACA GCGAGTGCGA GC 
 Assemble Data

18179R-2.IR_full       1   CCAGGTGACCATTTCCGAGGGTGCCGAGGGCCGCATCGTCAACGGTTACCCAGCGCCCGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18179R-2.in silico     1   CCAGGTGACCATTTCCGAGGGTGCCGAGGGCCGCATCGTCAACGGTTACCCAGCGCCCGA 60


18179R-2.IR_full       61  GGGAAAGGCTCCCTACATTGTGGGACTGTTGATCCGCACTGATGGAAGCAACAGTGCCGC 120
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
18179R-2.in silico     61  GGGAAAGGCTCCCTACATTGTGGGACTGTTGATCCGCACCGATGGAAGCAACAGTGCCGC 120


18179R-2.IR_full       121 GGTTGGAGCTGGAACCATCATCGCCAGCGACTGGATTCTGACCGCCGCTCACTGTCTGAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18179R-2.in silico     121 GGTTGGAGCTGGAACCATCATCGCCAGCGACTGGATTCTGACCGCCGCTCACTGTCTGAC 180


18179R-2.IR_full       181 CACCGACTACGTGGAGATCCACTATGGATCCAACTGGGGCTGGAACGGAGCTTTCAGGCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18179R-2.in silico     181 CACCGACTACGTGGAGATCCACTATGGATCCAACTGGGGCTGGAACGGAGCTTTCAGGCA 240


18179R-2.IR_full       241 ATCTGTCCGCCGTGACAACTTTATCAGCCATCCAAACTGGCCCGCTGAGGGCGGTCGNTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
18179R-2.in silico     241 ATCTGTCCGCCGTGACAACTTTATCAGCCATCCAAACTGGCCCGCTGAGGGCGGTCG-TG 300


18179R-2.IR_full       301 ACATCGGTCTGATCCGCACTNCCCTCCGTGGGCTTCACCGACTTGATCAACAAGGTCGCC 360
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
18179R-2.in silico     301 ACATCGGTCTGATCCGCACT-CCCTCCGTGGGCTTCACCGACTTGATCAACAAGGTCGCC 360


18179R-2.IR_full       361 CTGCCAAGCTTCAGCGAGGAGAGCGACCGCTTTGTGGACACCTGGTGCGTTGCCTGCGGA 420
                           |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||
18179R-2.in silico     361 CTGCCAAGCTTCAGCGAGGAGAGCGACCGCTTCGTGGACACATGGTGCGTTGCCTGCGGA 420


18179R-2.IR_full       421 TGGGGCGGCATGGACAATGGCAACCTGGCCGACTGGCTGCAGTGCATGGACGTCCAGATC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18179R-2.in silico     421 TGGGGCGGCATGGACAATGGCAACCTGGCCGACTGGCTGCAGTGCATGGACGTCCAGATC 480


18179R-2.IR_full       481 ATCAGCAACAGCGAGTGCGAGC 502
                           ||||||||||||||||||||||
18179R-2.in silico     481 ATCAGCAACAGCGAGTGCGAGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140083.1  CG18179-RA (CG18179), mRNA 
6.01   29  77  72  124  NM_140084.1  CG18180-RA (CG18180), mRNA 
0.41   NM_057423.3  CG18444-RA (alphaTry), mRNA 
0.41   NM_078970.3  CG12351-RA (deltaTry), mRNA 
0.41   NM_165824.1  CG30031-RA (CG30031), mRNA 
0.41   NM_165825.1  CG30025-RA (CG30025), mRNA 
0.41   NM_165823.1  CG30028-RA (gammaTry), mRNA 
0.2   NM_137572.2  CG10062-RA (CG10062), mRNA 
0   10  19  18  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
0   10  32  NM_140082.1  CG8329-RA (CG8329), mRNA 
0   NM_168316.1  CG4821-RB, transcript variant B (Tequila), mRNA 
0   NM_168314.1  CG4821-RD, transcript variant D (Tequila), mRNA 
0   NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
0   NM_165031.1  CG31728-RA (CG31728), mRNA 
0   13  16  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0   NM_080165.1  CG18211-RA (betaTry), mRNA 
0   23  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0   23  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0   17  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0   NM_170654.1  CG10772-RA, transcript variant A (Fur1), mRNA 
0   NM_080146.2  CG10772-RB, transcript variant B (Fur1), mRNA 
0   NM_206570.1  CG10772-RF, transcript variant F (Fur1), mRNA 
0   NM_170655.1  CG10772-RC, transcript variant C (Fur1), mRNA 
0   NM_206571.1  CG10772-RE, transcript variant E (Fur1), mRNA 
0   NM_170656.1  CG10772-RD, transcript variant D (Fur1), mRNA 
0   NM_139492.2  CG2103-RA, transcript variant A (pgant6), mRNA 
0   NM_167966.1  CG2103-RB, transcript variant B (pgant6), mRNA 
0   12  25  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   30  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0   20  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.