National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18179R-1 
 Symbol CG18179  Full Name CG18179 
 CG No CG18179  Old CG No CG18179 
 Synonyms SP152, BEST:LP02275, CG18179 
 Accession No (Link to NCBI) NM_140083.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCAGGTGACCATTTCCGAGGGTGCCGAGGGCCGCATCGTCAACGGTTACCCAGCGCCCGA 60

                           ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     61  GGGAAAGGCTCCCTACATTGTGGGACTGTTGATCCGCACCGATGGAAGCAACAGTGCCGC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGTTGGAGCTGGAACCATCATCGCCAGCGACTGGATTCTGACCGCCGCTCACTGTCTGAC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CACCGACTACGTGGAGATCCACTATGGATCCAACTGGGGCTGGAACGGAGCTTTCAGGCA 240

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     241 ATCTGTCCGCCGTGACAACTTTATCAGCCATCCAAACTGGCCCGCTGAGGGCGGTCG-TG 300

                           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| silico     301 ACATCGGTCTGATCCGCACT-CCCTCCGTGGGCTTCACCGACTTGATCAACAAGGTCGCC 360

                           |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| silico     361 CTGCCAAGCTTCAGCGAGGAGAGCGACCGCTTCGTGGACACATGGTGCGTTGCCTGCGGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGGGGCGGCATGGACAATGGCAACCTGGCCGACTGGCTGCAGTGCATGGACGTCCAGATC 480

18179R-1.IR_full       481 ATCAGCAACAGCGAGTGCGAGC 502
                           |||||||||||||||||||||| silico     481 ATCAGCAACAGCGAGTGCGAGC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140083.1  CG18179-RA (CG18179), mRNA 
6.01   29  77  72  124  NM_140084.1  CG18180-RA (CG18180), mRNA 
0.41   NM_057423.3  CG18444-RA (alphaTry), mRNA 
0.41   NM_078970.3  CG12351-RA (deltaTry), mRNA 
0.41   NM_165824.1  CG30031-RA (CG30031), mRNA 
0.41   NM_165825.1  CG30025-RA (CG30025), mRNA 
0.41   NM_165823.1  CG30028-RA (gammaTry), mRNA 
0.2   NM_137572.2  CG10062-RA (CG10062), mRNA 
0   10  19  18  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
0   10  32  NM_140082.1  CG8329-RA (CG8329), mRNA 
0   NM_168316.1  CG4821-RB, transcript variant B (Tequila), mRNA 
0   NM_168314.1  CG4821-RD, transcript variant D (Tequila), mRNA 
0   NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
0   NM_165031.1  CG31728-RA (CG31728), mRNA 
0   13  16  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0   NM_080165.1  CG18211-RA (betaTry), mRNA 
0   23  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0   23  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0   17  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0   NM_170654.1  CG10772-RA, transcript variant A (Fur1), mRNA 
0   NM_080146.2  CG10772-RB, transcript variant B (Fur1), mRNA 
0   NM_206570.1  CG10772-RF, transcript variant F (Fur1), mRNA 
0   NM_170655.1  CG10772-RC, transcript variant C (Fur1), mRNA 
0   NM_206571.1  CG10772-RE, transcript variant E (Fur1), mRNA 
0   NM_170656.1  CG10772-RD, transcript variant D (Fur1), mRNA 
0   NM_139492.2  CG2103-RA, transcript variant A (pgant6), mRNA 
0   NM_167966.1  CG2103-RB, transcript variant B (pgant6), mRNA 
0   12  25  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   30  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0   20  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.