National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18128R-2 
 Symbol CG18128  Full Name CG18128 
 CG No CG18128  Old CG No CG18128 
 Synonyms CG18128 
 Accession No (Link to NCBI) NM_137978.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.<br> A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.<br> PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.<br> RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.<br> Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGCAACTACGACTGCTGCAA 
 Primer Seq. 3'
aatctagaggtaccTTATGTCGCCCAGGGCGAATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGCAACTAC GACTGCTGCA AGTCCAGGTC GCCGATTGCC AAGCGAATGG CGGCCAGGAA 
0061 GCTTCTGCAG ATGGAGGAGG AGGAACGCCG GNAAGCCCAA GCTGGTCATC CCGACGCCCC 
0121 AGAGCCTCTT CTACCCCTTC GAGGAAGTGG AGGCCATGGC CAAGNTACAT CGTGAACGTT 
0181 AGCCACATCC GGCCAAAGTA CGGACTAATC TGCGGCAGCT TCCTGAGCGA TATGGTCAGC 
0241 TTGGTGGAGC AGCCGGTGGT CATTCCCTAC GAGGACATAC CCAACTTCCC CGACGGCATA 
0301 GAGCCGGACT GCAGCTTCGT CTNTGGGCAC GGTCATGGGA GCGCCCATAA TAGCGCTGGT 
0361 CCACAGTTTC CACTCCTGCG ACGGCTACAA CCTGGCCACC TGTNCGCTGC CCGTCCGCGT 
0421 GATGCAGTTG TGCGGGGTCA GGACCATCAT GCTGACCTCT GAAGCAGCGG CCGTAGATCA 
0481 CGGANTcNCC CTGGGCGACA TAA 
 in silico PCR Fragment
0001 GTGCAACTAC GACTGCTGCA AGTCCAGGTC GCCGATTGCC AAGCGAATGG CGGCCAGGAA 
0061 GCTTCTGCAG ATGGAGGAGG AGGAACGCCG G-AAGCCCAA GCTGGTCATC CCGACGCCCC 
0121 AGAGCCTCTT CTACCCCTTC GAGGAAGTCG AGGCCATGGC CAAG-TACAT CGTGAACGTT 
0181 AGCCACATCA GGCCAAAGTA CGGACTAATC TGCGGCAGCT TCCTGAGCGA TATGGTCAGC 
0241 TTGGTGGAGC AGCCGGTGGT CATTCCCTAC GAGGACATAC CCAACTTCCC CGACGGCATA 
0301 GAGCCGGACT GCAGCTTCGT CT-TGGGCAC GGTCATGGGA GCGCCCATAA TAGCGCTGGT 
0361 CCACAGTTTC CACTCCTGCG ACGGCTACAA CCTGGCCACC TGTGCGCTGC CCGTCCGCGT 
0421 GATGCAGTTG TGCGGGGTCA GGACCATCAT GCTGACCTCT GAAGCAGCGG CCGTAGATCA 
0481 CGGATTCGCC CTGGGCGACA TAA 
 Assemble Data
<PRE>

18128R-2.IR_full       1   GTGCAACTACGACTGCTGCAAGTCCAGGTCGCCGATTGCCAAGCGAATGGCGGCCAGGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18128R-2.in silico     1   GTGCAACTACGACTGCTGCAAGTCCAGGTCGCCGATTGCCAAGCGAATGGCGGCCAGGAA 60


18128R-2.IR_full       61  GCTTCTGCAGATGGAGGAGGAGGAACGCCGG<span class="snp"><tt>N</tt></span>AAGCCCAAGCTGGTCATCCCGACGCCCC 120
                           |||||||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>||||||||||||||||||||||||||||
18128R-2.in silico     61  GCTTCTGCAGATGGAGGAGGAGGAACGCCGG<span class="snp"><tt>-</tt></span>AAGCCCAAGCTGGTCATCCCGACGCCCC 120


18128R-2.IR_full       121 AGAGCCTCTTCTACCCCTTCGAGGAAGT<span class="snp"><tt>G</tt></span>GAGGCCATGGCCAAG<span class="snp"><tt>N</tt></span>TACATCGTGAACGTT 180
                           ||||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>|||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>|||||||||||||||
18128R-2.in silico     121 AGAGCCTCTTCTACCCCTTCGAGGAAGT<span class="snp"><tt>C</tt></span>GAGGCCATGGCCAAG<span class="snp"><tt>-</tt></span>TACATCGTGAACGTT 180


18128R-2.IR_full       181 AGCCACATC<span class="snp"><tt>C</tt></span>GGCCAAAGTACGGACTAATCTGCGGCAGCTTCCTGAGCGATATGGTCAGC 240
                           |||||||||<span class="snp"><tt>&nbsp;</tt></span>||||||||||||||||||||||||||||||||||||||||||||||||||
18128R-2.in silico     181 AGCCACATC<span class="snp"><tt>A</tt></span>GGCCAAAGTACGGACTAATCTGCGGCAGCTTCCTGAGCGATATGGTCAGC 240


18128R-2.IR_full       241 TTGGTGGAGCAGCCGGTGGTCATTCCCTACGAGGACATACCCAACTTCCCCGACGGCATA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18128R-2.in silico     241 TTGGTGGAGCAGCCGGTGGTCATTCCCTACGAGGACATACCCAACTTCCCCGACGGCATA 300


18128R-2.IR_full       301 GAGCCGGACTGCAGCTTCGTCT<span class="snp"><tt>N</tt></span>TGGGCACGGTCATGGGAGCGCCCATAATAGCGCTGGT 360
                           ||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>|||||||||||||||||||||||||||||||||||||
18128R-2.in silico     301 GAGCCGGACTGCAGCTTCGTCT<span class="snp"><tt>-</tt></span>TGGGCACGGTCATGGGAGCGCCCATAATAGCGCTGGT 360


18128R-2.IR_full       361 CCACAGTTTCCACTCCTGCGACGGCTACAACCTGGCCACCTGT<span class="snp"><tt>N</tt></span>CGCTGCCCGTCCGCGT 420
                           |||||||||||||||||||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>||||||||||||||||
18128R-2.in silico     361 CCACAGTTTCCACTCCTGCGACGGCTACAACCTGGCCACCTGT<span class="snp"><tt>G</tt></span>CGCTGCCCGTCCGCGT 420


18128R-2.IR_full       421 GATGCAGTTGTGCGGGGTCAGGACCATCATGCTGACCTCTGAAGCAGCGGCCGTAGATCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18128R-2.in silico     421 GATGCAGTTGTGCGGGGTCAGGACCATCATGCTGACCTCTGAAGCAGCGGCCGTAGATCA 480


18128R-2.IR_full       481 CGGA<span class="snp"><tt>N</tt></span>TC<span class="snp"><tt>N</tt></span>CCCTGGGCGACATAA 503
                           ||||<span class="snp"><tt>&nbsp;</tt></span>||<span class="snp"><tt>&nbsp;</tt></span>|||||||||||||||
18128R-2.in silico     481 CGGA<span class="snp"><tt>T</tt></span>TC<span class="snp"><tt>G</tt></span>CCCTGGGCGACATAA 503

</PRE>
 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137978.1  CG18128-RA (CG18128), mRNA 
0   NM_206262.1  CG12734-RB, transcript variant B (CG12734), mRNA 
0   NM_139523.1  CG12734-RA, transcript variant A (CG12734), mRNA 
0   NM_140225.3  CG6091-RA, transcript variant A (CG6091), mRNA 
0   NM_168465.2  CG6091-RC, transcript variant C (CG6091), mRNA 
0   NM_140301.1  CG11529-RA (CG11529), mRNA 
0   NM_143573.1  CG15545-RA (CG15545), mRNA 
0   12  NM_170038.1  CG31151-RB, transcript variant B (wge), mRNA 
0   12  NM_170037.1  CG31151-RA, transcript variant A (wge), mRNA 
0   12  NM_001043281.1  CG31151-RC, transcript variant C (wge), mRNA 
0   NM_137119.2  CG10105-RA (CG10105), mRNA 
0   NM_001043208.1  CG41467-RA, transcript variant A (CG41467), mRNA 
0   NM_144196.1  CG8620-RA (CG8620), mRNA 
0   NM_078545.2  CG12653-RA (btd), mRNA 
0   NM_136902.2  CG8858-RA (CG8858), mRNA 
0   NM_139462.1  CG13800-RA (CG13800), mRNA 
0   NM_141574.2  CG13318-RA (CG13318), mRNA 
0   NM_176508.1  CG3962-RC, transcript variant C (Keap1), mRNA 
0   NM_142337.1  CG3962-RA, transcript variant A (Keap1), mRNA 
0   NM_169744.1  CG3962-RB, transcript variant B (Keap1), mRNA 
0   NM_176472.1  CG3359-RK, transcript variant K (mfas), mRNA 
0   NM_176470.1  CG3359-RP, transcript variant P (mfas), mRNA 
0   NM_176468.1  CG3359-RD, transcript variant D (mfas), mRNA 
0   NM_176475.1  CG3359-RF, transcript variant F (mfas), mRNA 
0   NM_176469.1  CG3359-RL, transcript variant L (mfas), mRNA 
0   NM_079600.2  CG3359-RC, transcript variant C (mfas), mRNA 
0   NM_176474.1  CG3359-RO, transcript variant O (mfas), mRNA 
0   NM_176476.1  CG3359-RG, transcript variant G (mfas), mRNA 
0   NM_176478.1  CG3359-RJ, transcript variant J (mfas), mRNA 
0   NM_176467.1  CG3359-RN, transcript variant N (mfas), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
   
 Pathways (updated: 2024/04/26)
 KEGG Pathway dme00230 : Purine metabolism
dme00760 : Nicotinate and nicotinamide metabolism
dme01100 : Metabolic pathways
dme01232 : Nucleotide metabolism

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.