National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18104R-1 
 Symbol arg  Full Name arginase 
 CG No CG18104  Old CG No CG18104 
 Synonyms EG:65F1.3, EG:171D11.4, CG18104, arg 
 Accession No (Link to NCBI) NM_080136.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGGTGGAGCCGTAAATTTGC 
 Primer Seq. 3'
aatctagaggtaccACTGCGAGGTGCTATGCAGAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGGTGGAGC CGTAAATTTG CCTCAAGGTC TCTCCGCCTC CACCGGCTCA AGAGCACCGG 
0061 AAAGCACTGC GCCCAGGGAA CCTGAGCAAT CTCTAGGCAT CATTGGAGTG CCCTTCGCAA 
0121 AGGGGCAGGC CAAGCAGGGC GTGGTAACTG GCGCCAGATC TTCTCCGGCA GAGCAGTCTG 
0181 CGTCAGGTGC TTCAGAGCAG TCATGATGGC CTGGTGATAC GGGACTACGG AAATCTGCAG 
0241 TACGCCGTAG ACGAGCCCCT TCTCCAGCAG CAGCGTGTGC ACTATCACCA CATCCGAAAC 
0301 TACGCGGACT TCATGGCCTG CAATCGGGCA CTGATTGAAC AGGTGAAACT CATGCTCGTG 
0361 GAGAACACGC AGTTTTTAGC CATTGGTGGT GATCATGCGA TCGGCTTCGG ATCCGTGGCC 
0421 GGGCACCTGC AACACACGCC GAATTTGTCC CTGGTGTGGA TCGACGCACA TGCGGACATC 
0481 AATCTGCATA GCACCTCGCA GT 
 in silico PCR Fragment
0001 GTGGTGGAGC CGTAAATTTG CCTCAAGGTC TCTCCGCCTC CACCGGCTCA AGAGCACCGG 
0061 -AAGCACTGC GCCCAGGGAA CCTGAGCAAT CTCTAGGCAT CATTGGAGTG CCCTTCGCAA 
0121 AGGGGCAGGC CAAGCAGGGC GTGG-AACTG GCGCCAGATC TTCTCCGGCA GAGCAGTCTG 
0181 CGTCAGGTGC TTCAGAGCAG TCATGATGGC CTGGTGATAC GGGACTACGG AAATCTGCAG 
0241 TACGCCGTAG ACGAGCCCCT TCTCCAGCAG CAGCGTGTGC ACTATCACCA CATCCGAAAC 
0301 TACGCGGACT TCATGGCCTG CAATCGGGCA CTGATTGAAC AGGTGAAACT CATGCTCGTG 
0361 GAGAACACGC AGTTTTTAGC CATTGGTGGT GATCATGCGA TCGGCTTCGG ATCCGTGGCC 
0421 GGGCACCTGC AACACACGCC GAATTTGTCC CTGGTGTGGA TCGACGCACA TGCGGACATC 
0481 AATCTGCATA GCACCTCGCA GT 
 Assemble Data

18104R-1.IR_full        1   TGGTGGAGCCGTAAATTTGCCTCAAGGTCTCTCCGCCTCCACCGGCTCAAGAGCACCGG 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18104R-1.in silico      1   TGGTGGAGCCGTAAATTTGCCTCAAGGTCTCTCCGCCTCCACCGGCTCAAGAGCACCGG 59


18104R-1.IR_full       61  AAAGCACTGCGCCCAGGGAACCTGAGCAATCTCTAGGCATCATTGGAGTGCCCTTCGCAA 119
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18104R-1.in silico     61  -AAGCACTGCGCCCAGGGAACCTGAGCAATCTCTAGGCATCATTGGAGTGCCCTTCGCAA 119


18104R-1.IR_full       121 AGGGGCAGGCCAAGCAGGGCGTGGTAACTGGCGCCAGATCTTCTCCGGCAGAGCAGTCTG 179
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
18104R-1.in silico     121 AGGGGCAGGCCAAGCAGGGCGTGG-AACTGGCGCCAGATCTTCTCCGGCAGAGCAGTCTG 179


18104R-1.IR_full       181 CGTCAGGTGCTTCAGAGCAGTCATGATGGCCTGGTGATACGGGACTACGGAAATCTGCAG 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18104R-1.in silico     181 CGTCAGGTGCTTCAGAGCAGTCATGATGGCCTGGTGATACGGGACTACGGAAATCTGCAG 239


18104R-1.IR_full       241 TACGCCGTAGACGAGCCCCTTCTCCAGCAGCAGCGTGTGCACTATCACCACATCCGAAAC 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18104R-1.in silico     241 TACGCCGTAGACGAGCCCCTTCTCCAGCAGCAGCGTGTGCACTATCACCACATCCGAAAC 299


18104R-1.IR_full       301 TACGCGGACTTCATGGCCTGCAATCGGGCACTGATTGAACAGGTGAAACTCATGCTCGTG 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18104R-1.in silico     301 TACGCGGACTTCATGGCCTGCAATCGGGCACTGATTGAACAGGTGAAACTCATGCTCGTG 359


18104R-1.IR_full       361 GAGAACACGCAGTTTTTAGCCATTGGTGGTGATCATGCGATCGGCTTCGGATCCGTGGCC 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18104R-1.in silico     361 GAGAACACGCAGTTTTTAGCCATTGGTGGTGATCATGCGATCGGCTTCGGATCCGTGGCC 419


18104R-1.IR_full       421 GGGCACCTGCAACACACGCCGAATTTGTCCCTGGTGTGGATCGACGCACATGCGGACATC 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18104R-1.in silico     421 GGGCACCTGCAACACACGCCGAATTTGTCCCTGGTGTGGATCGACGCACATGCGGACATC 479


18104R-1.IR_full       481 AATCTGCATAGCACCTCGCAGT 501
                           ||||||||||||||||||||||
18104R-1.in silico     481 AATCTGCATAGCACCTCGCAGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080136.1  CG18104-RA (arg), mRNA 
0.41   NM_167189.2  CG32705-RA (CG32705), mRNA 
0.2   NM_141433.2  CG1104-RA, transcript variant A (CG1104), mRNA 
0.2   NM_169165.1  CG1104-RB, transcript variant B (CG1104), mRNA 
0   NM_132823.1  CG15646-RA (CG15646), mRNA 
0   NM_167455.1  CG12708-RA (CG12708), mRNA 
0   NM_141752.2  CG14689-RA (CG14689), mRNA 
0   NM_079208.2  CG4633-RA (Aats-ala-m), mRNA 
0   NM_080296.2  CG16785-RA (fz3), mRNA 
0   NM_130502.2  CG12311-RA (Pomt2), mRNA 
0   NM_137683.3  CG15649-RA (CG15649), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_001032020.1  CG7217-RB, transcript variant B (CG7217), mRNA 
0   NM_142422.3  CG7217-RA, transcript variant A (CG7217), mRNA 
0   NM_142423.2  CG7215-RA, transcript variant A (CG7215), mRNA 
0   NM_167377.1  CG11178-RA, transcript variant A (CG11178), mRNA 
0   NM_132673.2  CG11178-RB, transcript variant B (CG11178), mRNA 
0   NM_136337.2  CG17337-RA (CG17337), mRNA 
0   NM_206203.1  CG30194-RC, transcript variant C (CG30194), mRNA 
0   NM_206204.1  CG30194-RD, transcript variant D (CG30194), mRNA 
0   NM_137905.2  CG30194-RB, transcript variant B (CG30194), mRNA 
0   NM_057956.2  CG10269-RA (D19A), mRNA 
0   NM_141810.1  CG6719-RA (CG6719), mRNA 
0   NM_078579.2  CG1505-RA (gd), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_133136.1  CG7874-RA (CG7874), mRNA 
0   10  NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_164692.2  CG31638-RA (CG31638), mRNA 
0   NM_137200.2  CG30467-RA (CG30467), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.