National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18063R-3 
 Symbol CG18063  Full Name CG18063 
 CG No CG18063  Old CG No CG18063 
 Synonyms DS07486.5, BG:DS07486.5, CG18063 
 Accession No (Link to NCBI) NM_135931.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTTCAAAGCGGCTCGCACAATTCAGCGTTATATTCACGGATGGCTAGTTCGAGAAAATTT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCGAAAACTTCAGAAGTCTGCGATTATTATTCAAAAATGGTGGCGCCGTTTTGAGGCTCA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAAAAATTTGCTTTATGTGGCCGAAAGCGCTTTGCAGTCGGCTGTTTTGGCCCATTACGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CAAGTCTGCTACCCTGATTCAGACGCTCTATCGCGGATGGTGGTCGCGAAAACATATCTT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGACCTAACCATGCTCAAGAGCGTGCAGATAATGTTGGCAAAGGACCTGATTCACTCTTT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGTCAATTACTTGCACGCAACGAAAAATTCTGAAATGCTTCCAGGCATTTACACGATACG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGACTCGAGCATATGTCTGGAAACATTGGAGGAACTGATGGCAACATTTGGCTTTCGATT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTATAACGCTAATGCTTGCTACAAAATGAAGGAAACGTTGTCAATGGTGGCACAGAGCCG 480

18063R-3.IR_full       481 AAAGACGTTTACGGCCACAT 500
                           |||||||||||||||||||| silico     481 AAAGACGTTTACGGCCACAT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135931.1  CG18063-RA, transcript variant A (CG18063), mRNA 
100   482  NM_165141.1  CG18063-RB, transcript variant B (CG18063), mRNA 
0   NM_079224.3  CG10037-RA (vvl), mRNA 
0   NM_136937.2  CG8525-RA (CG8525), mRNA 
0   NM_134967.2  CG3980-RB, transcript variant B (CG3980), mRNA 
0   NM_164563.2  CG3980-RA, transcript variant A (CG3980), mRNA 
0   NM_135168.3  CG9491-RA (Gef26), mRNA 
0   NM_134507.1  CG14234-RA (CG14234), mRNA 
0   NM_079494.3  CG8779-RA, transcript variant A (nrm), mRNA 
0   NM_001043156.1  CG8779-RB, transcript variant B (nrm), mRNA 
0   NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
0   NM_143432.2  CG31445-RA (CG31445), mRNA 
0   NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
0   NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_176464.1  CG31211-RB, transcript variant B (CG31211), mRNA 
0   NM_141874.2  CG31211-RA, transcript variant A (CG31211), mRNA 
0   NM_176465.1  CG31211-RC, transcript variant C (CG31211), mRNA 
0   NM_057674.2  CG11482-RA (Mlh1), mRNA 
0   NM_079764.2  CG6875-RA (asp), mRNA 
0   NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   NM_167251.1  CG1691-RF, transcript variant F (Imp), mRNA 
0   NM_165130.1  CG3903-RB, transcript variant B (Gli), mRNA 
0   NM_057254.3  CG3903-RA, transcript variant A (Gli), mRNA 
0   NM_165128.1  CG3903-RD, transcript variant D (Gli), mRNA 
0   NM_165127.1  CG3903-RC, transcript variant C (Gli), mRNA 
0   NM_057768.2  CG7779-RA (Cng), mRNA 
0   NM_057471.4  CG4260-RA, transcript variant A (alpha-Adaptin), mRNA 
0   NM_165129.1  CG3903-RE, transcript variant E (Gli), mRNA 
0   NM_166591.1  CG30416-RA (CG30416), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.