National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18063R-2 
 Symbol CG18063  Full Name CG18063 
 CG No CG18063  Old CG No CG18063 
 Synonyms DS07486.5, BG:DS07486.5, CG18063 
 Accession No (Link to NCBI) NM_135931.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTCAAAGCGGCTCGCACAAT 
 Primer Seq. 3'
aatctagaggtaccATGTGGCCGTAAACGTCTTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTTCAAAGCG GCTCGCACAA TTCAGCGTTA TATTCACGGA TGGCTAGTTC GAGAAAATTT 
0061 CCGAAAACTT CAGAAGTCTG CGATTATTAT TCAAAAATGG TGGCGCCGTT TTGAGGCTCA 
0121 GAAAAATTTG CTTTATGTGG CCGAAAGCGC TTTGCAGTCG GCTGTTTTGG CCCATTACGA 
0181 CAAGTCTGCT ACCCTGATTC AGACGCTCTA TCGCGGATGG TGGTCGCGAA AACATATCTT 
0241 TGACCTAACC ATGCTCAAGA GCGTGCAGAT AATGTTGGCA AAGGACCTGA TTCACTCTTT 
0301 GGTCAATTAC TTGCACGCAA CGAAAAATTC TGAAATGCTT CCAGGCATTT ACACGATACG 
0361 GGACTCGAGC ATATGTCTGG AAACATTGGA GGAACTGATG GCAACATTTG GCTTTCGATT 
0421 CTATAACGCT AATGCTTGCT ACAAAATGAA GGAAACGTTG TCAATGGTGG CACAGAGCCG 
0481 AAAGACGTTT ACGGCCACAT  
 in silico PCR Fragment
0001 GTTCAAAGCG GCTCGCACAA TTCAGCGTTA TATTCACGGA TGGCTAGTTC GAGAAAATTT 
0061 CCGAAAACTT CAGAAGTCTG CGATTATTAT TCAAAAATGG TGGCGCCGTT TTGAGGCTCA 
0121 GAAAAATTTG CTTTATGTGG CCGAAAGCGC TTTGCAGTCG GCTGTTTTGG CCCATTACGA 
0181 CAAGTCTGCT ACCCTGATTC AGACGCTCTA TCGCGGATGG TGGTCGCGAA AACATATCTT 
0241 TGACCTAACC ATGCTCAAGA GCGTGCAGAT AATGTTGGCA AAGGACCTGA TTCACTCTTT 
0301 GGTCAATTAC TTGCACGCAA CGAAAAATTC TGAAATGCTT CCAGGCATTT ACACGATACG 
0361 GGACTCGAGC ATATGTCTGG AAACATTGGA GGAACTGATG GCAACATTTG GCTTTCGATT 
0421 CTATAACGCT AATGCTTGCT ACAAAATGAA GGAAACGTTG TCAATGGTGG CACAGAGCCG 
0481 AAAGACGTTT ACGGCCACAT  
 Assemble Data

18063R-2.IR_full       1   GTTCAAAGCGGCTCGCACAATTCAGCGTTATATTCACGGATGGCTAGTTCGAGAAAATTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18063R-2.in silico     1   GTTCAAAGCGGCTCGCACAATTCAGCGTTATATTCACGGATGGCTAGTTCGAGAAAATTT 60


18063R-2.IR_full       61  CCGAAAACTTCAGAAGTCTGCGATTATTATTCAAAAATGGTGGCGCCGTTTTGAGGCTCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18063R-2.in silico     61  CCGAAAACTTCAGAAGTCTGCGATTATTATTCAAAAATGGTGGCGCCGTTTTGAGGCTCA 120


18063R-2.IR_full       121 GAAAAATTTGCTTTATGTGGCCGAAAGCGCTTTGCAGTCGGCTGTTTTGGCCCATTACGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18063R-2.in silico     121 GAAAAATTTGCTTTATGTGGCCGAAAGCGCTTTGCAGTCGGCTGTTTTGGCCCATTACGA 180


18063R-2.IR_full       181 CAAGTCTGCTACCCTGATTCAGACGCTCTATCGCGGATGGTGGTCGCGAAAACATATCTT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18063R-2.in silico     181 CAAGTCTGCTACCCTGATTCAGACGCTCTATCGCGGATGGTGGTCGCGAAAACATATCTT 240


18063R-2.IR_full       241 TGACCTAACCATGCTCAAGAGCGTGCAGATAATGTTGGCAAAGGACCTGATTCACTCTTT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18063R-2.in silico     241 TGACCTAACCATGCTCAAGAGCGTGCAGATAATGTTGGCAAAGGACCTGATTCACTCTTT 300


18063R-2.IR_full       301 GGTCAATTACTTGCACGCAACGAAAAATTCTGAAATGCTTCCAGGCATTTACACGATACG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18063R-2.in silico     301 GGTCAATTACTTGCACGCAACGAAAAATTCTGAAATGCTTCCAGGCATTTACACGATACG 360


18063R-2.IR_full       361 GGACTCGAGCATATGTCTGGAAACATTGGAGGAACTGATGGCAACATTTGGCTTTCGATT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18063R-2.in silico     361 GGACTCGAGCATATGTCTGGAAACATTGGAGGAACTGATGGCAACATTTGGCTTTCGATT 420


18063R-2.IR_full       421 CTATAACGCTAATGCTTGCTACAAAATGAAGGAAACGTTGTCAATGGTGGCACAGAGCCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18063R-2.in silico     421 CTATAACGCTAATGCTTGCTACAAAATGAAGGAAACGTTGTCAATGGTGGCACAGAGCCG 480


18063R-2.IR_full       481 AAAGACGTTTACGGCCACAT 500
                           ||||||||||||||||||||
18063R-2.in silico     481 AAAGACGTTTACGGCCACAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135931.1  CG18063-RA, transcript variant A (CG18063), mRNA 
100   482  NM_165141.1  CG18063-RB, transcript variant B (CG18063), mRNA 
0   NM_079224.3  CG10037-RA (vvl), mRNA 
0   NM_136937.2  CG8525-RA (CG8525), mRNA 
0   NM_134967.2  CG3980-RB, transcript variant B (CG3980), mRNA 
0   NM_164563.2  CG3980-RA, transcript variant A (CG3980), mRNA 
0   NM_135168.3  CG9491-RA (Gef26), mRNA 
0   NM_134507.1  CG14234-RA (CG14234), mRNA 
0   NM_079494.3  CG8779-RA, transcript variant A (nrm), mRNA 
0   NM_001043156.1  CG8779-RB, transcript variant B (nrm), mRNA 
0   NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
0   NM_143432.2  CG31445-RA (CG31445), mRNA 
0   NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
0   NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_176464.1  CG31211-RB, transcript variant B (CG31211), mRNA 
0   NM_141874.2  CG31211-RA, transcript variant A (CG31211), mRNA 
0   NM_176465.1  CG31211-RC, transcript variant C (CG31211), mRNA 
0   NM_057674.2  CG11482-RA (Mlh1), mRNA 
0   NM_079764.2  CG6875-RA (asp), mRNA 
0   NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   NM_167251.1  CG1691-RF, transcript variant F (Imp), mRNA 
0   NM_165130.1  CG3903-RB, transcript variant B (Gli), mRNA 
0   NM_057254.3  CG3903-RA, transcript variant A (Gli), mRNA 
0   NM_165128.1  CG3903-RD, transcript variant D (Gli), mRNA 
0   NM_165127.1  CG3903-RC, transcript variant C (Gli), mRNA 
0   NM_057768.2  CG7779-RA (Cng), mRNA 
0   NM_057471.4  CG4260-RA, transcript variant A (alpha-Adaptin), mRNA 
0   NM_165129.1  CG3903-RE, transcript variant E (Gli), mRNA 
0   NM_166591.1  CG30416-RA (CG30416), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.