National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 18033R-1 
 Symbol msta  Full Name msta 
 CG No CG33548  Old CG No CG18033 
 Synonyms Msta, EG:103B4.4, CG18033, CG32799, EG:103B4.5, CG32800, CG33548, msta 
 Accession No (Link to NCBI) NM_001014718.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTAGCACACCTGTTACAGAGGA 
 Primer Seq. 3'
aatctagaggtaccGCATGGCATACAGCAACTTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TAGCACACCT GTTACAGAGG AACCGAGATC CTCAAGCCAA ATGACCATCA GTGCGTCCAC 
0061 GCAGGAATTA GCCGAACTGA TAAACATCCA CTTGGGTGAC CTGCGACCGG AGGAGCCCTC 
0121 TTGGCGGGTG GCCGACTCTC CAATTTCCGG TAGGGGCATC TTTGCCACCA GAGAAATAGC 
0181 CGCTGGCGAG GAGCTCTTCC GTGAGCACAC GTTGCTCGTG GGTCCAACAG CTCATAGGTC 
0241 CATGAATCTG CGCACTTGCA CCCTCTGCTA CCGCCTGATT CCGGGATCCA CGGACTCGGC 
0301 AGCCCTCTGC CCAGCCGGAT GCGGATTACC AGTTTGCTCG GAGTGCCGGG ACTCCACGCG 
0361 TCACGACCTA GAGTGCAAGC TCTTTCGCAA GTGGAAGCCT CTGGAGAGCC AGAGAATCGA 
0421 ACCGCGCGCC CTTAGGATTC TTAGTGTTGT GCGATGCTTC TTTCTGGACG AAGCCAGCCG 
0481 AAAGTTGCTG TATGcCATGC  
 in silico PCR Fragment
0001 TAGCACACCT GTTACAGAGG AACCGAGATC CTCAAGCCAA ATGACCATCA GTGCGTCCAC 
0061 GCAGGAATTA GCCGAACTGA TAAACATCCA CTTGGGTGAC CTGCGACCGG AGGAGCCCTC 
0121 TTGGCGGGTG GCCGACTCTC CAATTTCCGG TAGGGGCATC TTTGCCACCA GAGAAATAGC 
0181 CGCTGGCGAG GAGCTCTTCC GTGAGCACAC GTTGCTCGTG GGTCCAACAG CTCATAGGTC 
0241 CATGAATCTG CGCACTTGCA CCCTCTGCTA CCGCCTGATT CCGGGATCCA CGGACTCGGC 
0301 AGCCCTCTGC CCAGCCGGAT GCGGATTACC AGTTTGCTCG GAGTGCCGGG ACTCCACGCG 
0361 TCACGACCTA GAGTGCAAGC TCTTTCGCAA GTGGAAGCCT CTGGAGAGCC AGAGAATCGA 
0421 ACCGCGCGCC CTTAGGATTC TTAGTGTTGT GCGATGCTTC TTTCTGGACG AAGCCAGCCG 
0481 AAAGTTGCTG TATGCCATGC  
 Assemble Data

18033R-1.IR_full       1   TAGCACACCTGTTACAGAGGAACCGAGATCCTCAAGCCAAATGACCATCAGTGCGTCCAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18033R-1.in silico     1   TAGCACACCTGTTACAGAGGAACCGAGATCCTCAAGCCAAATGACCATCAGTGCGTCCAC 60


18033R-1.IR_full       61  GCAGGAATTAGCCGAACTGATAAACATCCACTTGGGTGACCTGCGACCGGAGGAGCCCTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18033R-1.in silico     61  GCAGGAATTAGCCGAACTGATAAACATCCACTTGGGTGACCTGCGACCGGAGGAGCCCTC 120


18033R-1.IR_full       121 TTGGCGGGTGGCCGACTCTCCAATTTCCGGTAGGGGCATCTTTGCCACCAGAGAAATAGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18033R-1.in silico     121 TTGGCGGGTGGCCGACTCTCCAATTTCCGGTAGGGGCATCTTTGCCACCAGAGAAATAGC 180


18033R-1.IR_full       181 CGCTGGCGAGGAGCTCTTCCGTGAGCACACGTTGCTCGTGGGTCCAACAGCTCATAGGTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18033R-1.in silico     181 CGCTGGCGAGGAGCTCTTCCGTGAGCACACGTTGCTCGTGGGTCCAACAGCTCATAGGTC 240


18033R-1.IR_full       241 CATGAATCTGCGCACTTGCACCCTCTGCTACCGCCTGATTCCGGGATCCACGGACTCGGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18033R-1.in silico     241 CATGAATCTGCGCACTTGCACCCTCTGCTACCGCCTGATTCCGGGATCCACGGACTCGGC 300


18033R-1.IR_full       301 AGCCCTCTGCCCAGCCGGATGCGGATTACCAGTTTGCTCGGAGTGCCGGGACTCCACGCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18033R-1.in silico     301 AGCCCTCTGCCCAGCCGGATGCGGATTACCAGTTTGCTCGGAGTGCCGGGACTCCACGCG 360


18033R-1.IR_full       361 TCACGACCTAGAGTGCAAGCTCTTTCGCAAGTGGAAGCCTCTGGAGAGCCAGAGAATCGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18033R-1.in silico     361 TCACGACCTAGAGTGCAAGCTCTTTCGCAAGTGGAAGCCTCTGGAGAGCCAGAGAATCGA 420


18033R-1.IR_full       421 ACCGCGCGCCCTTAGGATTCTTAGTGTTGTGCGATGCTTCTTTCTGGACGAAGCCAGCCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
18033R-1.in silico     421 ACCGCGCGCCCTTAGGATTCTTAGTGTTGTGCGATGCTTCTTTCTGGACGAAGCCAGCCG 480


18033R-1.IR_full       481 AAAGTTGCTGTATGCCATGC 500
                           ||||||||||||||||||||
18033R-1.in silico     481 AAAGTTGCTGTATGCCATGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001014718.1  CG33548-RB, transcript variant B (msta), mRNA 
0.2   NM_164696.1  CG31635-RA (CG31635), mRNA 
0   NM_166232.1  CG30104-RB, transcript variant B (CG30104), mRNA 
0   NM_137374.2  CG30104-RA, transcript variant A (CG30104), mRNA 
0   NM_139420.1  CG12361-RA (CG12361), mRNA 
0   NM_141401.1  CG2330-RA (CG2330), mRNA 
0   NM_001038871.1  CG34020-RA (CG34020), mRNA 
0   NM_143572.2  CG12045-RA (CG12045), mRNA 
0   NM_141297.1  CG2926-RA (CG2926), mRNA 
0   NM_139990.2  CG5971-RA (CG5971), mRNA 
0   10  20  NM_001014717.1  CG33548-RA, transcript variant A (msta), mRNA 
0   NM_132293.2  CG7041-RA (HP1b), mRNA 
0   NM_079699.2  CG5685-RA, transcript variant A (Calx), mRNA 
0   NM_169940.1  CG5685-RB, transcript variant B (Calx), mRNA 
0   NM_169941.1  CG5685-RC, transcript variant C (Calx), mRNA 
0   NM_169761.1  CG31190-RA, transcript variant A (CG31190), mRNA 
0   NM_206504.1  CG31190-RB, transcript variant B (CG31190), mRNA 
0   NM_078548.2  CG2985-RA (Yp1), mRNA 
0   NM_134318.1  CG10327-RC, transcript variant C (TBPH), mRNA 
0   NM_137373.2  CG4827-RA (CG4827), mRNA 
0   NM_169108.1  CG31555-RA (CG31555), mRNA 
0   NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_136639.1  CG8800-RA (CG8800), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_167020.1  CG6986-RB, transcript variant B (CG6986), mRNA 
0   NM_131955.1  CG6986-RA, transcript variant A (CG6986), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.