National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1801R-2 
 Symbol CG1801  Full Name CG1801 
 CG No CG1801  Old CG No CG1801 
 Synonyms CG1801 
 Accession No (Link to NCBI) NM_167739.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hosono C, Matsuda R, Adryan B, Samakovlis C.
Transient junction anisotropies orient annular cell polarization in the Drosophila airway tubes.
Nat Cell Biol (2015) 17(12) 1569-76 [ PubMed ID = 26551273 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGCCAGCAAGGGTCTTCTTT 
 Primer Seq. 3'
aatctagaggtaccATCCTCGGTGAGGAACGGAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGGCCAGCAA GGGTCTTCTT TTCAAGCGCT ACATCCGCAT CGAGTTAAAT CTGTGGCGGC 
0061 GGACGcTCTT CGAGATCGTC GCCCTAGTGA TAATGGTCCT AGTGATCTTT CTCAACCCCA 
0121 TCGCTCACTC CAAAAGGCTT CTATACACGA CCACCGAGAA CGAAAACGAG CAGAGCATCG 
0181 TGTCCCACAA ACTGCAGGAC ATAAATATAT TGACACGCAT GGCAGACTCG AAGCGGGAGA 
0241 AAACCAAGTA CATCCTGGCC TTCACGCCGG AAACGACGTT TACATCGGAG GTGACCAAGA 
0301 ATGTGGCCAA AACGCTGGAA CTGAGCTCAA CCGTGGGCTA CGAGAGCGAG TCCGAAATGC 
0361 AAAATCAGTT CGATGAGCGG ACTACCCTGG CGGGCATTGT TTTCAATGAT CTGCGCGATG 
0421 ACGGCACTCC TTTGACTCTG TCCATCTCGA TTCGGTTTCC CAGCGAGTTC CGCACGATCG 
0481 CTCCGTTCCT CACCGAGGAT  
 in silico PCR Fragment
0001 CGGCCAGCAA GGGTCTTCTT TTCAAGCGCT ACATCCGCAT CGAGTTAAAT CTGTGGCGGC 
0061 GGACGCTCTT CGAGATCGTC GCCCTAGTGA TAATGGTCCT AGTGATCTTT CTCAACCCCA 
0121 TCGCTCACTC CAAAAGGCTT CTATACACGA CCACCGAGAA CGAAAACGAG CAGAGCATCG 
0181 TGTCCCACAA ACTGCAGGAC ATAAATATAT TGACACGCAT GGCAGACTCG AAGCGGGAGA 
0241 AAACCAAGTA CATCCTGGCC TTCACGCCGG AAACGACGTT TACATCGGAG GTGACCAAGA 
0301 ATGTGGCCAA AACGCTGGAA CTGAGCTCAA CCGTGGGCTA CGAGAGCGAG TCCGAAATGC 
0361 AAAATCAGTT CGATGAGCGG ACTACCCTGG CGGGCATTGT TTTCAATGAT CTGCGCGATG 
0421 ACGGCACTCC TTTGACTCTG TCCATCTCGA TTCGGTTTCC CAGCGAGTTC CGCACGATCG 
0481 CTCCGTTCCT CACCGAGGAT  
 Assemble Data

1801R-2.IR_full       1   CGGCCAGCAAGGGTCTTCTTTTCAAGCGCTACATCCGCATCGAGTTAAATCTGTGGCGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1801R-2.in silico     1   CGGCCAGCAAGGGTCTTCTTTTCAAGCGCTACATCCGCATCGAGTTAAATCTGTGGCGGC 60


1801R-2.IR_full       61  GGACGCTCTTCGAGATCGTCGCCCTAGTGATAATGGTCCTAGTGATCTTTCTCAACCCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1801R-2.in silico     61  GGACGCTCTTCGAGATCGTCGCCCTAGTGATAATGGTCCTAGTGATCTTTCTCAACCCCA 120


1801R-2.IR_full       121 TCGCTCACTCCAAAAGGCTTCTATACACGACCACCGAGAACGAAAACGAGCAGAGCATCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1801R-2.in silico     121 TCGCTCACTCCAAAAGGCTTCTATACACGACCACCGAGAACGAAAACGAGCAGAGCATCG 180


1801R-2.IR_full       181 TGTCCCACAAACTGCAGGACATAAATATATTGACACGCATGGCAGACTCGAAGCGGGAGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1801R-2.in silico     181 TGTCCCACAAACTGCAGGACATAAATATATTGACACGCATGGCAGACTCGAAGCGGGAGA 240


1801R-2.IR_full       241 AAACCAAGTACATCCTGGCCTTCACGCCGGAAACGACGTTTACATCGGAGGTGACCAAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1801R-2.in silico     241 AAACCAAGTACATCCTGGCCTTCACGCCGGAAACGACGTTTACATCGGAGGTGACCAAGA 300


1801R-2.IR_full       301 ATGTGGCCAAAACGCTGGAACTGAGCTCAACCGTGGGCTACGAGAGCGAGTCCGAAATGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1801R-2.in silico     301 ATGTGGCCAAAACGCTGGAACTGAGCTCAACCGTGGGCTACGAGAGCGAGTCCGAAATGC 360


1801R-2.IR_full       361 AAAATCAGTTCGATGAGCGGACTACCCTGGCGGGCATTGTTTTCAATGATCTGCGCGATG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1801R-2.in silico     361 AAAATCAGTTCGATGAGCGGACTACCCTGGCGGGCATTGTTTTCAATGATCTGCGCGATG 420


1801R-2.IR_full       421 ACGGCACTCCTTTGACTCTGTCCATCTCGATTCGGTTTCCCAGCGAGTTCCGCACGATCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1801R-2.in silico     421 ACGGCACTCCTTTGACTCTGTCCATCTCGATTCGGTTTCCCAGCGAGTTCCGCACGATCG 480


1801R-2.IR_full       481 CTCCGTTCCTCACCGAGGAT 500
                          ||||||||||||||||||||
1801R-2.in silico     481 CTCCGTTCCTCACCGAGGAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167739.2  CG1801-RA (CG1801), mRNA 
0   NM_168369.1  CG8177-RG, transcript variant G (CG8177), mRNA 
0   NM_168372.1  CG8177-RF, transcript variant F (CG8177), mRNA 
0   NM_168371.1  CG8177-RC, transcript variant C (CG8177), mRNA 
0   NM_206314.1  CG8177-RH, transcript variant H (CG8177), mRNA 
0   NM_206311.1  CG8177-RK, transcript variant K (CG8177), mRNA 
0   NM_206312.1  CG8177-RJ, transcript variant J (CG8177), mRNA 
0   NM_206313.1  CG8177-RI, transcript variant I (CG8177), mRNA 
0   NM_140100.1  CG8177-RA, transcript variant A (CG8177), mRNA 
0   NM_168370.1  CG8177-RB, transcript variant B (CG8177), mRNA 
0   NM_168373.1  CG8177-RE, transcript variant E (CG8177), mRNA 
0   NM_168374.1  CG8177-RD, transcript variant D (CG8177), mRNA 
0   NM_135226.2  CG11221-RA (CG11221), mRNA 
0   NM_136448.2  CG2144-RA (CG2144), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_058148.3  CG2637-RA (Fs(2)Ket), mRNA 
0   NM_170652.1  CG6643-RA, transcript variant A (CG6643), mRNA 
0   NM_170653.1  CG6643-RB, transcript variant B (CG6643), mRNA 
0   NM_134573.1  CG12092-RA (NPC1b), mRNA 
0   NM_078851.2  CG4192-RA (kek3), mRNA 
0   NM_140322.2  CG10657-RA (CG10657), mRNA 
0   NM_164830.3  CG18405-RA, transcript variant A (Sema-1a), mRNA 
0   NM_135399.2  CG18405-RB, transcript variant B (Sema-1a), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_130554.2  CG11448-RA (CG11448), mRNA 
0   NM_001042883.1  CG18405-RC, transcript variant C (Sema-1a), mRNA 
0   NM_133001.2  CG8289-RA (CG8289), mRNA 
0   NM_139956.1  CG7112-RA (CG7112), mRNA 
0   NM_057429.3  CG9703-RA, transcript variant A (Axs), mRNA 
0   NM_143027.2  CG5805-RA (CG5805), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.