National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1801R-1 
 Symbol CG1801  Full Name CG1801 
 CG No CG1801  Old CG No CG1801 
 Synonyms CG1801 
 Accession No (Link to NCBI) NM_167739.2 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGGCCAGCAAGGGTCTTCTTTTCAAGCGCTACATCCGCATCGAGTTAAATCTGTGGCGGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGACGCTCTTCGAGATCGTCGCCCTAGTGATAATGGTCCTAGTGATCTTTCTCAACCCCA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCGCTCACTCCAAAAGGCTTCTATACACGACCACCGAGAACGAAAACGAGCAGAGCATCG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGTCCCACAAACTGCAGGACATAAATATATTGACACGCATGGCAGACTCGAAGCGGGAGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAACCAAGTACATCCTGGCCTTCACGCCGGAAACGACGTTTACATCGGAGGTGACCAAGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATGTGGCCAAAACGCTGGAACTGAGCTCAACCGTGGGCTACGAGAGCGAGTCCGAAATGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AAAATCAGTTCGATGAGCGGACTACCCTGGCGGGCATTGTTTTCAATGATCTGCGCGATG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACGGCACTCCTTTGACTCTGTCCATCTCGATTCGGTTTCCCAGCGAGTTCCGCACGATCG 480

1801R-1.IR_full       481 CTCCGTTCCTCACCGAGGAT 500
                          |||||||||||||||||||| silico     481 CTCCGTTCCTCACCGAGGAT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167739.2  CG1801-RA (CG1801), mRNA 
0   NM_168369.1  CG8177-RG, transcript variant G (CG8177), mRNA 
0   NM_168372.1  CG8177-RF, transcript variant F (CG8177), mRNA 
0   NM_168371.1  CG8177-RC, transcript variant C (CG8177), mRNA 
0   NM_206314.1  CG8177-RH, transcript variant H (CG8177), mRNA 
0   NM_206311.1  CG8177-RK, transcript variant K (CG8177), mRNA 
0   NM_206312.1  CG8177-RJ, transcript variant J (CG8177), mRNA 
0   NM_206313.1  CG8177-RI, transcript variant I (CG8177), mRNA 
0   NM_140100.1  CG8177-RA, transcript variant A (CG8177), mRNA 
0   NM_168370.1  CG8177-RB, transcript variant B (CG8177), mRNA 
0   NM_168373.1  CG8177-RE, transcript variant E (CG8177), mRNA 
0   NM_168374.1  CG8177-RD, transcript variant D (CG8177), mRNA 
0   NM_135226.2  CG11221-RA (CG11221), mRNA 
0   NM_136448.2  CG2144-RA (CG2144), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_058148.3  CG2637-RA (Fs(2)Ket), mRNA 
0   NM_170652.1  CG6643-RA, transcript variant A (CG6643), mRNA 
0   NM_170653.1  CG6643-RB, transcript variant B (CG6643), mRNA 
0   NM_134573.1  CG12092-RA (NPC1b), mRNA 
0   NM_078851.2  CG4192-RA (kek3), mRNA 
0   NM_140322.2  CG10657-RA (CG10657), mRNA 
0   NM_164830.3  CG18405-RA, transcript variant A (Sema-1a), mRNA 
0   NM_135399.2  CG18405-RB, transcript variant B (Sema-1a), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_130554.2  CG11448-RA (CG11448), mRNA 
0   NM_001042883.1  CG18405-RC, transcript variant C (Sema-1a), mRNA 
0   NM_133001.2  CG8289-RA (CG8289), mRNA 
0   NM_139956.1  CG7112-RA (CG7112), mRNA 
0   NM_057429.3  CG9703-RA, transcript variant A (Axs), mRNA 
0   NM_143027.2  CG5805-RA (CG5805), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.