National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17998R-3 
 Symbol Gprk2  Full Name G protein-coupled receptor kinase 2 
 CG No CG17998  Old CG No CG17998 
 Synonyms 154978_at, gprk2, CG17998, Gprk-2, Gprk2 
 Accession No (Link to NCBI) NM_057519.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Valanne S, Myllymäki H, Kallio J, Schmid MR, Kleino A, Murumägi A, Airaksinen L, Kotipelto T, Kaustio M, Ulvila J, Esfahani SS, Engström Y, Silvennoinen O, Hultmark D, Parikka M, Rämet M.
Genome-wide RNA interference in Drosophila cells identifies G protein-coupled receptor kinase 2 as a conserved regulator of NF-kappaB signaling.
J. Immunol. (2010) 184(11) 6188-98 [ PubMed ID = 20421637 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCCAATACGGTCTACTTGA 
 Primer Seq. 3'
aatctagaggtaccGTGCTGCGAGTTGTTGCTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCCAATAC GGTCTACTTG AAAGCGAGAG AAGGTGGTTC CGACAGCAAC AAGGGAAAGA 
0061 GNCAAAAAAT GGCGCAAAAT ATTGCAATTC CCACACATAT CGCAATGCAT CAACCTGAAA 
0121 GACAAATTAG ATATAAGCTA TGGCTACGTG ATAGATCAGC AACCCATTGG TCGTGAGCTC 
0181 TTCCGTCTGT TTTGCGAGAA CAAACGGCCC GTCTACTTTC GCTACATCAC CTTCCTGGAT 
0241 GAGGTGGTCA AATACGAGAT CGAGTACATC TCGAACCGCA TATTCATTGG CCATGACATC 
0301 GGCCGTCGCT TCTTGGATGT CGAGGCACAG CTGGAGCTGC GCAACGGCAG CGGGGGCGAC 
0361 GCCTTGGACG CCGAGACGCA GGAGGAGCTG CTGCTCAACA GCAGCAATGC CAATCCAACT 
0421 GAAACAGCTG AGACTGAACA CTGCAACAAT ACCACCGCCA ACAACTGCAA CAACATCAAC 
0481 AACAGCAACA ACTCGCATGC Ac 
 in silico PCR Fragment
0001 TGGCCAATAC GGTCTACTTG AAAGCGAGAG AAGGTGGTTC CGACAGCAAC AAGGGAAAGA 
0061 G-CAAAAAAT GGCGCAAAAT ATTGCAATTC CCACACATAT CGCAATGCAT CAACCTGAAA 
0121 GACAAATTAG ATATAAGCTA TGGCTACGTG ATAGATCAGC AACCCATTGG TCGTGAGCTC 
0181 TTCCGTCTGT TTTGCGAGAA CAAACGGCCC GTCTACTTTC GCTACATCAC CTTCCTGGAT 
0241 GAGGTGGTCA AATACGAGAT CGAGTACATC TCGAACCGCA TATTCATTGG CCATGACATC 
0301 GGCCGTCGCT TCTTGGATGT CGAGGCACAG CTGGAGCTGC GCAACGGCAG CGGGGGCGAC 
0361 GCCTTGGACG CCGAGACGCA GGAGGAGCTG CTGCTCAACA GCAGCAATGC CAATCCAACT 
0421 GAAACAGCTG AGACTGAACA CTGCAACAAT ACCACCGCCA ACAACTGCAA CAACATCAAC 
0481 AACAGCAACA ACTCGCA-GC AC 
 Assemble Data

17998R-3.IR_full       1   TGGCCAATACGGTCTACTTGAAAGCGAGAGAAGGTGGTTCCGACAGCAACAAGGGAAAGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17998R-3.in silico     1   TGGCCAATACGGTCTACTTGAAAGCGAGAGAAGGTGGTTCCGACAGCAACAAGGGAAAGA 60


17998R-3.IR_full       61  GNCAAAAAATGGCGCAAAATATTGCAATTCCCACACATATCGCAATGCATCAACCTGAAA 120
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17998R-3.in silico     61  G-CAAAAAATGGCGCAAAATATTGCAATTCCCACACATATCGCAATGCATCAACCTGAAA 120


17998R-3.IR_full       121 GACAAATTAGATATAAGCTATGGCTACGTGATAGATCAGCAACCCATTGGTCGTGAGCTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17998R-3.in silico     121 GACAAATTAGATATAAGCTATGGCTACGTGATAGATCAGCAACCCATTGGTCGTGAGCTC 180


17998R-3.IR_full       181 TTCCGTCTGTTTTGCGAGAACAAACGGCCCGTCTACTTTCGCTACATCACCTTCCTGGAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17998R-3.in silico     181 TTCCGTCTGTTTTGCGAGAACAAACGGCCCGTCTACTTTCGCTACATCACCTTCCTGGAT 240


17998R-3.IR_full       241 GAGGTGGTCAAATACGAGATCGAGTACATCTCGAACCGCATATTCATTGGCCATGACATC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17998R-3.in silico     241 GAGGTGGTCAAATACGAGATCGAGTACATCTCGAACCGCATATTCATTGGCCATGACATC 300


17998R-3.IR_full       301 GGCCGTCGCTTCTTGGATGTCGAGGCACAGCTGGAGCTGCGCAACGGCAGCGGGGGCGAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17998R-3.in silico     301 GGCCGTCGCTTCTTGGATGTCGAGGCACAGCTGGAGCTGCGCAACGGCAGCGGGGGCGAC 360


17998R-3.IR_full       361 GCCTTGGACGCCGAGACGCAGGAGGAGCTGCTGCTCAACAGCAGCAATGCCAATCCAACT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17998R-3.in silico     361 GCCTTGGACGCCGAGACGCAGGAGGAGCTGCTGCTCAACAGCAGCAATGCCAATCCAACT 420


17998R-3.IR_full       421 GAAACAGCTGAGACTGAACACTGCAACAATACCACCGCCAACAACTGCAACAACATCAAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17998R-3.in silico     421 GAAACAGCTGAGACTGAACACTGCAACAATACCACCGCCAACAACTGCAACAACATCAAC 480


17998R-3.IR_full       481 AACAGCAACAACTCGCATGCAC 502
                           ||||||||||||||||| ||||
17998R-3.in silico     481 AACAGCAACAACTCGCA-GCAC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  17  NM_057519.3  CG17998-RA (Gprk2), mRNA 
1.03   45  156  NM_135615.2  CG6700-RA (CG6700), mRNA 
0.41   15  84  NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
0.41   13  74  NM_170062.1  CG10868-RB, transcript variant B (orb), mRNA 
0.41   13  74  NM_170063.2  CG10868-RD, transcript variant D (orb), mRNA 
0.41   58  NM_170064.1  CG10868-RC, transcript variant C (orb), mRNA 
0.41   58  NM_170065.2  CG10868-RE, transcript variant E (orb), mRNA 
0.2   17  36  NM_001038966.1  CG33967-RA (CG33967), mRNA 
0.2   17  71  NM_079015.2  CG8404-RA (Sox15), mRNA 
0.2   NM_057581.4  CG18466-RB, transcript variant B (Nmdmc), mRNA 
0.2   NM_057582.4  CG18466-RA, transcript variant A (Nmdmc), mRNA 
0   12  39  107  NM_166987.2  CG32781-RB (CG32781), mRNA 
0   10  45  195  NM_135077.2  CG14023-RA (CG14023), mRNA 
0   10  27  111  NM_079507.2  CG2530-RA (corto), mRNA 
0   19  24  NM_078692.2  CG11937-RA (amn), mRNA 
0   14  50  NM_164430.2  CG31666-RD, transcript variant D (CG31666), mRNA 
0   68  220  NM_078592.2  CG11172-RA (NFAT), mRNA 
0   30  88  NM_142521.1  CG6026-RA (CG6026), mRNA 
0   62  422  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   62  421  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   62  421  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   30  103  NM_176184.2  CG18250-RC, transcript variant C (Dg), mRNA 
0   25  133  NM_206357.2  CG33261-RD, transcript variant D (Trl), mRNA 
0   25  130  NM_206360.1  CG33261-RF, transcript variant F (Trl), mRNA 
0   25  130  NM_206358.2  CG33261-RA, transcript variant A (Trl), mRNA 
0   14  74  NM_078601.2  CG9533-RA (rut), mRNA 
0   11  21  NM_079128.2  CG4859-RB, transcript variant B (Mmp1), mRNA 
0   11  21  NM_166683.1  CG4859-RA, transcript variant A (Mmp1), mRNA 
0   146  376  NM_168571.2  CG32133-RA (CG32133), mRNA 
0   17  111  NM_167387.1  CG32611-RB (CG32611), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.