National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17960R-2 
 Symbol RhoGAP1A  Full Name RhoGAP1A 
 CG No CG00000  Old CG No CG17960 
 Synonyms EG:23E12.2, CG17960, EG:23E12.5, CG17617, BCR, CG40453, CG40494, RhoGAP1A, FBgn0025836 
 Accession No (Link to NCBI) NM_001103385 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACAAGAAGGCCATCCACGCA 
 Primer Seq. 3'
aatctagaggtaccCGCTGATTGACCACATTGAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACAAGAAGG CCATCCACGC AACCCTAACT ACTTCGCAGC CTGTGATCAG GGAGGAGGAG 
0061 GAGAACACAA TTTTCTTTAA AATTGATGAG CTTTACGATC TGCATACCGG TTTCTTATCT 
0121 GATTTAAAGA CTATTGTGTC TCACGAGGGT GGTGATGTGC TGATCGGTGA GCCGTTTCGT 
0181 CGACTGGCGG AGATGTTTGA CTTATACAGT GCCTTTTTGC ACAACTACAA AAATGCTATT 
0241 GAGACTGTGA AGAAGTGCAG TGCCAATAAC CCCCAGTTTA AAAAGATCGT CTCCACCATT 
0301 GTGCTTAATC TGCAGACGGA ACAATCGCTA ACTCTCGAGG ATCTATTGCA CAAACCTGTT 
0361 GCGAGGGTAC AAATCAACGC ATTGGTCTTC AACGATTTGC TACGCGAAAC CCCAAATGCG 
0421 CATCCGGATC ACCAGCCATT AAGGCAGGCG CAAAAGATTA TTCAGATGTT CCTCAATCAG 
0481 TTCAATGTGG TCAATCAGCG  
 in silico PCR Fragment
0001 TACAAGAAGG CCATCCACGC AACCCTAACT ACTTCGCAGC CTGTGATCAG GGAGGAGGAG 
0061 GAGAACACAA TTTTCTTTAA AATTGATGAG CTTTACGATC TGCATACCGG TTTCTTATCT 
0121 GATTTAAAGA CTATTGTGTC TCACGAGGGT GGTGATGTGC TGATCGGTGA GCCGTTTCGT 
0181 CGACTGGCGG AGATGTTTGA CTTATACAGT GCCTTTTTGC ACAACTACAA AAATGCTATT 
0241 GAGACTGTGA AGAAGTGCAG TGCCAATAAC CCCCAGTTTA AAAAGATCGT CTCCACCATT 
0301 GTGCTTAATC TGCAGACGGA ACAATCGCTA ACTCTCGAGG ATCTATTGCA CAAACCTGTT 
0361 GCGAGGGTAC AAATCAACGC ATTGGTCTTC AACGATTTGC TACGCGAAAC CCCAAATGCG 
0421 CATCCGGATC ACCAGCCATT AAGGCAGGCG CAAAAGATTA TTCAGATGTT CCTCAATCAG 
0481 TTCAATGTGG TCAATCAGCG  
 Assemble Data

17960R-2.IR_full       1   TACAAGAAGGCCATCCACGCAACCCTAACTACTTCGCAGCCTGTGATCAGGGAGGAGGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17960R-2.in silico     1   TACAAGAAGGCCATCCACGCAACCCTAACTACTTCGCAGCCTGTGATCAGGGAGGAGGAG 60


17960R-2.IR_full       61  GAGAACACAATTTTCTTTAAAATTGATGAGCTTTACGATCTGCATACCGGTTTCTTATCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17960R-2.in silico     61  GAGAACACAATTTTCTTTAAAATTGATGAGCTTTACGATCTGCATACCGGTTTCTTATCT 120


17960R-2.IR_full       121 GATTTAAAGACTATTGTGTCTCACGAGGGTGGTGATGTGCTGATCGGTGAGCCGTTTCGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17960R-2.in silico     121 GATTTAAAGACTATTGTGTCTCACGAGGGTGGTGATGTGCTGATCGGTGAGCCGTTTCGT 180


17960R-2.IR_full       181 CGACTGGCGGAGATGTTTGACTTATACAGTGCCTTTTTGCACAACTACAAAAATGCTATT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17960R-2.in silico     181 CGACTGGCGGAGATGTTTGACTTATACAGTGCCTTTTTGCACAACTACAAAAATGCTATT 240


17960R-2.IR_full       241 GAGACTGTGAAGAAGTGCAGTGCCAATAACCCCCAGTTTAAAAAGATCGTCTCCACCATT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17960R-2.in silico     241 GAGACTGTGAAGAAGTGCAGTGCCAATAACCCCCAGTTTAAAAAGATCGTCTCCACCATT 300


17960R-2.IR_full       301 GTGCTTAATCTGCAGACGGAACAATCGCTAACTCTCGAGGATCTATTGCACAAACCTGTT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17960R-2.in silico     301 GTGCTTAATCTGCAGACGGAACAATCGCTAACTCTCGAGGATCTATTGCACAAACCTGTT 360


17960R-2.IR_full       361 GCGAGGGTACAAATCAACGCATTGGTCTTCAACGATTTGCTACGCGAAACCCCAAATGCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17960R-2.in silico     361 GCGAGGGTACAAATCAACGCATTGGTCTTCAACGATTTGCTACGCGAAACCCCAAATGCG 420


17960R-2.IR_full       421 CATCCGGATCACCAGCCATTAAGGCAGGCGCAAAAGATTATTCAGATGTTCCTCAATCAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17960R-2.in silico     421 CATCCGGATCACCAGCCATTAAGGCAGGCGCAAAAGATTATTCAGATGTTCCTCAATCAG 480


17960R-2.IR_full       481 TTCAATGTGGTCAATCAGCG 500
                           ||||||||||||||||||||
17960R-2.in silico     481 TTCAATGTGGTCAATCAGCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.