National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1794-1R-1 
 Symbol Mmp2  Full Name Matrix metalloproteinase 2 
 CG No CG1794  Old CG No CG1794 
 Synonyms dm-2MMP, l(2)02353, 2-MMP, Dm2-MMP, CG1794, MMP2, anon-WO0118547.84, Mmp2 
 Accession No (Link to NCBI) NM_136667.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAAATATGTTCTCGCCACCC 
 Primer Seq. 3'
aatctagaggtaccGATCCGTTCTGGACCACTTGG 
 Predicted Fragment Size
438 
 IR fragment full Seq
0001 CCAAATATGT TCTCGCCACC CTGCTCGCAC TCTTTGCGCA ATCCATGTGC ATCCAGGAGC 
0061 TGTCCCTCCC ACCCGAAGGA TCTCACTCCA CCGCTGCGAC CAGGTCCAAG AAGGCAAAAA 
0121 CCGCTATCTC CGAGGATATA ATGTACAATT ACCTCATGCA GTTTGATTAT CTGCCCAAGT 
0181 CGGACCTGGA AANCGGGTGC TCTGCGCACC GAGGACCAGC TGAAAGAAGC AATCCGGAGT 
0241 CTCCAGTCTT TTGGCAACAT TACAGTTACG GGCGAAATCG ACTCGGCAAC GGCCCGGCTA 
0301 ATACAGAAAC CTCGGTGCGG CGTGGGCGAC AGAAGGTCCG CGGACAGCTT CTCGCCAGAT 
0361 AACCTGTATC ACGAAATCGG CTCCAATGTG CGGGTGCGGC NCTTCgCCCT GCAGGNACCC 
0421 AAGTGGTCCA GAACGGATC 
 in silico PCR Fragment
0001 CCAAATATGT TCTCGCCACC CTGCTCGCAC TCTTTGCGCA ATCCATGTGC ATCCAGGAGC 
0061 TGTCCCTCCC ACCCGAAGGA TCTCACTCCA CCGCTGCGAC CAGGTCCAAG AAGGCAAAAA 
0121 CCGCTATCTC CGAGGATATA ATGTACAATT ACCTCATGCA GTTTGATTAT CTGCCCAAGT 
0181 CGGACCTGGA AA-CGGGTGC TCTGCGCACC GAGGACCAGC TGAAAGAAGC AATCCGGAGT 
0241 CTCCAGTCTT TTGGCAACAT TACAGTTACG GGCGAAATCG ACTCGGCAAC GGCCCGGCTA 
0301 ATACAGAAAC CTCGGTGCGG CGTGGGCGAC AGAAGGTCCG CGGACAGCTT CTCGCCAGAT 
0361 AACCTGTATC ACGAAATCGG CTCCAATGTG CGGGTGCGGC GCTTCGCCCT GCAGGGACCC 
0421 AAGTGGTCCA GAACGGATC 
 Assemble Data

1794-1R-1.IR_full       1   CCAAATATGTTCTCGCCACCCTGCTCGCACTCTTTGCGCAATCCATGTGCATCCAGGAGC 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1794-1R-1.in silico     1   CCAAATATGTTCTCGCCACCCTGCTCGCACTCTTTGCGCAATCCATGTGCATCCAGGAGC 60


1794-1R-1.IR_full       61  TGTCCCTCCCACCCGAAGGATCTCACTCCACCGCTGCGACCAGGTCCAAGAAGGCAAAAA 120
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1794-1R-1.in silico     61  TGTCCCTCCCACCCGAAGGATCTCACTCCACCGCTGCGACCAGGTCCAAGAAGGCAAAAA 120


1794-1R-1.IR_full       121 CCGCTATCTCCGAGGATATAATGTACAATTACCTCATGCAGTTTGATTATCTGCCCAAGT 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1794-1R-1.in silico     121 CCGCTATCTCCGAGGATATAATGTACAATTACCTCATGCAGTTTGATTATCTGCCCAAGT 180


1794-1R-1.IR_full       181 CGGACCTGGAAANCGGGTGCTCTGCGCACCGAGGACCAGCTGAAAGAAGCAATCCGGAGT 240
                            |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
1794-1R-1.in silico     181 CGGACCTGGAAA-CGGGTGCTCTGCGCACCGAGGACCAGCTGAAAGAAGCAATCCGGAGT 240


1794-1R-1.IR_full       241 CTCCAGTCTTTTGGCAACATTACAGTTACGGGCGAAATCGACTCGGCAACGGCCCGGCTA 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1794-1R-1.in silico     241 CTCCAGTCTTTTGGCAACATTACAGTTACGGGCGAAATCGACTCGGCAACGGCCCGGCTA 300


1794-1R-1.IR_full       301 ATACAGAAACCTCGGTGCGGCGTGGGCGACAGAAGGTCCGCGGACAGCTTCTCGCCAGAT 360
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1794-1R-1.in silico     301 ATACAGAAACCTCGGTGCGGCGTGGGCGACAGAAGGTCCGCGGACAGCTTCTCGCCAGAT 360


1794-1R-1.IR_full       361 AACCTGTATCACGAAATCGGCTCCAATGTGCGGGTGCGGCNCTTCGCCCTGCAGGNACCC 420
                            |||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||
1794-1R-1.in silico     361 AACCTGTATCACGAAATCGGCTCCAATGTGCGGGTGCGGCGCTTCGCCCTGCAGGGACCC 420


1794-1R-1.IR_full       421 AAGTGGTCCAGAACGGATC 439
                            |||||||||||||||||||
1794-1R-1.in silico     421 AAGTGGTCCAGAACGGATC 439

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   420  NM_136667.2  CG1794-RA, transcript variant A (Mmp2), mRNA 
100   420  NM_206066.1  CG1794-RB, transcript variant B (Mmp2), mRNA 
0   NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   NM_170650.3  CG31045-RC, transcript variant C (Mhcl), mRNA 
0   NM_001043251.1  CG31045-RF, transcript variant F (Mhcl), mRNA 
0   NM_001043250.1  CG31045-RG, transcript variant G (Mhcl), mRNA 
0   NM_169700.2  CG31045-RA, transcript variant A (Mhcl), mRNA 
0   NM_167350.1  CG32637-RA (CG32637), mRNA 
0   NM_134658.2  CG11617-RA (CG11617), mRNA 
0   NM_131960.1  CG6978-RA (CG6978), mRNA 
0   NM_133018.2  CG6492-RA (Ucp4A), mRNA 
0   NM_137205.2  CG8195-RA (CG8195), mRNA 
0   NM_141967.2  CG6802-RA (Cyp313a4), mRNA 
0   NM_135106.1  CG7236-RA (CG7236), mRNA 
0   NM_140439.2  CG5842-RA (nan), mRNA 
0   NM_169935.1  CG31191-RA (CG31191), mRNA 
0   NM_136339.2  CG7791-RA (CG7791), mRNA 
0   NM_135391.2  CG13095-RA (CG13095), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 
0   NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
0   NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_139498.1  CG9965-RA (CG9965), mRNA 
0   NM_140866.1  CG9299-RA (CG9299), mRNA 
0   NM_140396.1  CG10738-RB, transcript variant B (CG10738), mRNA 
0   NM_168547.1  CG10738-RA, transcript variant A (CG10738), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.