National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17896R-4 
 Symbol CG17896  Full Name CG17896 
 CG No CG17896  Old CG No CG17896 
 Synonyms 153323_at, EG:171D11.1, CG17896 
 Accession No (Link to NCBI) NM_130489.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCAGTTTCAGTGTAGCCACCGTTCGGAGAGCACGCGATCCGATCCCCGCACCAAATTCTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATCTCCGTATCCCCAAGATGTCCCTAGTGCGATTGATCGGAGCAGAGGCCCGCCATCTGG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAAAGAGGTCCTACTCTTCAGCCGCTCCCACAACCAAGCTCTTCATCGACGGCAAGTTCG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTGAGTCGAAGACGAACGAATGGATTGACGTGCACGATCCGGCCACCAACCAAGTGGTCA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCCGCGTGCCCAAGGCCACACAGGCGGAGATGCAGGCGGCCCTTGAGTCGAACAAGAAGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTTTTCGCTCGTGGAGCAACCAGTCGATCCTCACCCGCCAGCAGGTGATGTTCAAGCTGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGCTCTCATCAAGGAGAACATGGGTGAGCTGGCCAAGAACATTACCAAGGAGCAGGGCA 420

                           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     421 AAACCTTGGCCGACGCAGAGGGCGACGTGCTC-CGCGGCCTTCAGGTGGTGGAACATTGC 480

17896R-4.IR_full       481 TGCAGCATCC 490
                           |||||||||| silico     481 TGCAGCATCC 490

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.