National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17896R-2 
 Symbol CG17896  Full Name CG17896 
 CG No CG17896  Old CG No CG17896 
 Synonyms 153323_at, EG:171D11.1, CG17896 
 Accession No (Link to NCBI) NM_130489.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCGCTGCGTTCAGTTTCAGT 
 Primer Seq. 3'
aatctagaggtaccGGATGCTGCAGCAATGTTCCA 
 Predicted Fragment Size
489 
 IR fragment full Seq
0001 TCAGTTTCAG TGTAGCCACC GTTCGGAGAG CACGCGATCC GATCCCCGCA CCAAATTCTC 
0061 ATCTCCGTAT CCCCAAGATG TCCCTAGTGC GATTGATCGG AGCAGAGGCC CGCCATCTGG 
0121 CAAAGAGGTC CTACTCTTCA GCCGCTCCCA CAACCAAGCT CTTCATCGAC GGCAAGTTCG 
0181 TTGAGTCGAA GACGAACGAA TGGATTGACG TGCACGATCC GGCCACCAAC CAAGTGGTCA 
0241 CCCGCGTGCC CAAGGCCACA CAGGCGGAGA TGCAGGCGGC CCTTGAGTCG AACAAGAAGG 
0301 CTTTTCGCTC GTGGAGCAAC CAGTCGATCC TCACCCGCCA GCAGGTGATG TTCAAGCTGC 
0361 AGGCTCTCAT CAAGGAGAAC ATGGGTGAGC TGGCCAAGAA CATTACCAAG GAGCAGGGCA 
0421 AAACCTTGGC CGACGCAGAG GGCGACGTGC TCGCGCGGCC TTCAGGTGGT GGAACATTGC 
0481 TGCAGCATCC  
 in silico PCR Fragment
0001 TCAGTTTCAG TGTAGCCACC GTTCGGAGAG CACGCGATCC GATCCCCGCA CCAAATTCTC 
0061 ATCTCCGTAT CCCCAAGATG TCCCTAGTGC GATTGATCGG AGCAGAGGCC CGCCATCTGG 
0121 CAAAGAGGTC CTACTCTTCA GCCGCTCCCA CAACCAAGCT CTTCATCGAC GGCAAGTTCG 
0181 TTGAGTCGAA GACGAACGAA TGGATTGACG TGCACGATCC GGCCACCAAC CAAGTGGTCA 
0241 CCCGCGTGCC CAAGGCCACA CAGGCGGAGA TGCAGGCGGC CCTTGAGTCG AACAAGAAGG 
0301 CTTTTCGCTC GTGGAGCAAC CAGTCGATCC TCACCCGCCA GCAGGTGATG TTCAAGCTGC 
0361 AGGCTCTCAT CAAGGAGAAC ATGGGTGAGC TGGCCAAGAA CATTACCAAG GAGCAGGGCA 
0421 AAACCTTGGC CGACGCAGAG GGCGACGTGC TC-CGCGGCC TTCAGGTGGT GGAACATTGC 
0481 TGCAGCATCC  
 Assemble Data

17896R-2.IR_full       1   TCAGTTTCAGTGTAGCCACCGTTCGGAGAGCACGCGATCCGATCCCCGCACCAAATTCTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17896R-2.in silico     1   TCAGTTTCAGTGTAGCCACCGTTCGGAGAGCACGCGATCCGATCCCCGCACCAAATTCTC 60


17896R-2.IR_full       61  ATCTCCGTATCCCCAAGATGTCCCTAGTGCGATTGATCGGAGCAGAGGCCCGCCATCTGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17896R-2.in silico     61  ATCTCCGTATCCCCAAGATGTCCCTAGTGCGATTGATCGGAGCAGAGGCCCGCCATCTGG 120


17896R-2.IR_full       121 CAAAGAGGTCCTACTCTTCAGCCGCTCCCACAACCAAGCTCTTCATCGACGGCAAGTTCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17896R-2.in silico     121 CAAAGAGGTCCTACTCTTCAGCCGCTCCCACAACCAAGCTCTTCATCGACGGCAAGTTCG 180


17896R-2.IR_full       181 TTGAGTCGAAGACGAACGAATGGATTGACGTGCACGATCCGGCCACCAACCAAGTGGTCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17896R-2.in silico     181 TTGAGTCGAAGACGAACGAATGGATTGACGTGCACGATCCGGCCACCAACCAAGTGGTCA 240


17896R-2.IR_full       241 CCCGCGTGCCCAAGGCCACACAGGCGGAGATGCAGGCGGCCCTTGAGTCGAACAAGAAGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17896R-2.in silico     241 CCCGCGTGCCCAAGGCCACACAGGCGGAGATGCAGGCGGCCCTTGAGTCGAACAAGAAGG 300


17896R-2.IR_full       301 CTTTTCGCTCGTGGAGCAACCAGTCGATCCTCACCCGCCAGCAGGTGATGTTCAAGCTGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17896R-2.in silico     301 CTTTTCGCTCGTGGAGCAACCAGTCGATCCTCACCCGCCAGCAGGTGATGTTCAAGCTGC 360


17896R-2.IR_full       361 AGGCTCTCATCAAGGAGAACATGGGTGAGCTGGCCAAGAACATTACCAAGGAGCAGGGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17896R-2.in silico     361 AGGCTCTCATCAAGGAGAACATGGGTGAGCTGGCCAAGAACATTACCAAGGAGCAGGGCA 420


17896R-2.IR_full       421 AAACCTTGGCCGACGCAGAGGGCGACGTGCTCGCGCGGCCTTCAGGTGGTGGAACATTGC 480
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
17896R-2.in silico     421 AAACCTTGGCCGACGCAGAGGGCGACGTGCTC-CGCGGCCTTCAGGTGGTGGAACATTGC 480


17896R-2.IR_full       481 TGCAGCATCC 490
                           ||||||||||
17896R-2.in silico     481 TGCAGCATCC 490

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
#NAME?     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.