National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17885R-1 
 Symbol Or1a  Full Name Odorant receptor 1a 
 CG No CG17885  Old CG No CG17885 
 Synonyms OR1a, 1a, DOR68, 1A.1, CG17885, Or1a 
 Accession No (Link to NCBI) NM_080290.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATCTGTGGACGCAGCGTTTT 
 Primer Seq. 3'
aatctagaggtaccGGTTGTGTCACATCGTATGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AATCTGTGGA CGCAGCGTTT TACCTTCGCC CGAATGGGTT TGGATTTGCA GCCCGATAAA 
0061 AAGGGCAATG TTTTGCGATC TCCGCTTCTT TATTGTATTA TGTGTCTGAC AACAAGCTTT 
0121 GAGCTCTGCA CCGTGTGCGC CTTTATGGTC CAAAATCGCA ACCAAATCGT GCTTTGTTCC 
0181 GAGGCCCTGA TGCACGGACT ACAGATGGTC TCCTCGCTAC TGAAGATGGC TATATTCTTG 
0241 GCCAAATCTC ACGACCTGGT GGACCTAATT CAACAGATTC AGTCGCCTTT TACAGAGGAG 
0301 GATCTTGTAG GTACAGAGTG GAGATCCCAA AATCAAAGGG GACAACTAAT GGCTGCCATT 
0361 TACTTTATGA TGTGTGCCGG TACGAGTGTG TCATTTCTGT TGATGCCAGT GGCTTTGACC 
0421 ATGCTTAAGT ACCATTCCAC TGGGGAATTC GCGCCTGTCA GCTCGTTCCG GGTTCTGTGA 
0481 NNANTCTTCC ATACGATGTG ACACAACC 
 in silico PCR Fragment
0001 AATCTGTGGA CGCAGCGTTT TACCTTCGCC CGAATGGGTT TGGATTTGCA GCCCGATAAA 
0061 AAGGGCAATG TTTTGCGATC TCCGCTTCTT TATTGTATTA TGTGTCTGAC AACAAGCTTT 
0121 GAGCTCTGCA CCGTGTGCGC CTTTATGGTC CAAAATCGCA ACCAAATCGT GCTTTGTTCC 
0181 GAGGCCCTGA TGCACGGACT ACAGATGGTC TCCTCGCTAC TGAAGATGGC TATATTCTTG 
0241 GCCAAATCTC ACGACCTGGT GGACCTAATT CAACAGATTC AGTCGCCTTT TACAGAGGAG 
0301 GATCTTGTAG GTACAGAGTG GAGATCCCAA AATCAAAGGG GACAACTAAT GGCTGCCATT 
0361 TACTTTATGA TGTGTGCCGG TACGAGTGTG TCATTTCTGT TGATGCCAGT GGCTTTGACC 
0421 ATGCTTAAGT ACCATTCCAC TGGGGAATTC GCGCCTGTCA GCTCGTTCCG GGTTCTG--- 
0481 -----CTTCC ATACGATGTG ACACAACC 
 Assemble Data

17885R-1.IR_full       1   AATCTGTGGACGCAGCGTTTTACCTTCGCCCGAATGGGTTTGGATTTGCAGCCCGATAAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17885R-1.in silico     1   AATCTGTGGACGCAGCGTTTTACCTTCGCCCGAATGGGTTTGGATTTGCAGCCCGATAAA 60


17885R-1.IR_full       61  AAGGGCAATGTTTTGCGATCTCCGCTTCTTTATTGTATTATGTGTCTGACAACAAGCTTT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17885R-1.in silico     61  AAGGGCAATGTTTTGCGATCTCCGCTTCTTTATTGTATTATGTGTCTGACAACAAGCTTT 120


17885R-1.IR_full       121 GAGCTCTGCACCGTGTGCGCCTTTATGGTCCAAAATCGCAACCAAATCGTGCTTTGTTCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17885R-1.in silico     121 GAGCTCTGCACCGTGTGCGCCTTTATGGTCCAAAATCGCAACCAAATCGTGCTTTGTTCC 180


17885R-1.IR_full       181 GAGGCCCTGATGCACGGACTACAGATGGTCTCCTCGCTACTGAAGATGGCTATATTCTTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17885R-1.in silico     181 GAGGCCCTGATGCACGGACTACAGATGGTCTCCTCGCTACTGAAGATGGCTATATTCTTG 240


17885R-1.IR_full       241 GCCAAATCTCACGACCTGGTGGACCTAATTCAACAGATTCAGTCGCCTTTTACAGAGGAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17885R-1.in silico     241 GCCAAATCTCACGACCTGGTGGACCTAATTCAACAGATTCAGTCGCCTTTTACAGAGGAG 300


17885R-1.IR_full       301 GATCTTGTAGGTACAGAGTGGAGATCCCAAAATCAAAGGGGACAACTAATGGCTGCCATT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17885R-1.in silico     301 GATCTTGTAGGTACAGAGTGGAGATCCCAAAATCAAAGGGGACAACTAATGGCTGCCATT 360


17885R-1.IR_full       361 TACTTTATGATGTGTGCCGGTACGAGTGTGTCATTTCTGTTGATGCCAGTGGCTTTGACC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17885R-1.in silico     361 TACTTTATGATGTGTGCCGGTACGAGTGTGTCATTTCTGTTGATGCCAGTGGCTTTGACC 420


17885R-1.IR_full       421 ATGCTTAAGTACCATTCCACTGGGGAATTCGCGCCTGTCAGCTCGTTCCGGGTTCTGTGA 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   
17885R-1.in silico     421 ATGCTTAAGTACCATTCCACTGGGGAATTCGCGCCTGTCAGCTCGTTCCGGGTTCTG--- 480


17885R-1.IR_full        N481 ANTCTTCCATACGATGTGACACAACC 506
                                |||||||||||||||||||||||
17885R-1.in silico      -481 ---CTTCCATACGATGTGACACAACC 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080290.3  CG17885-RA (Or1a), mRNA 
0   NM_168226.1  CG32377-RA (CG32377), mRNA 
0   NM_079876.2  CG1483-RA, transcript variant A (Map205), mRNA 
0   NM_170586.1  CG1483-RB, transcript variant B (Map205), mRNA 
0   NM_058003.3  CG5216-RA (Sir2), mRNA 
0   NM_165025.1  CG9828-RB, transcript variant B (DnaJ-H), mRNA 
0   NM_079295.2  CG6539-RA (Dhh1), mRNA 
0   NM_080325.3  CG6450-RC (lva), mRNA 
0   NM_134665.2  CG3345-RA (CG3345), mRNA 
0   NM_137617.3  CG11209-RA (ppk6), mRNA 
0   NM_080322.2  CG32498-RF, transcript variant F (dnc), mRNA 
0   NM_164370.1  CG31974-RA (CG31974), mRNA 
0   NM_136043.2  CG10413-RA (CG10413), mRNA 
0   NM_142624.2  CG15685-RA (CG15685), mRNA 
0   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_078747.2  CG2969-RA, transcript variant A (Atet), mRNA 
0   NM_170248.1  CG31091-RA (CG31091), mRNA 
0   NM_057724.3  CG18000-RI, transcript variant I (sw), mRNA 
0   NM_057722.3  CG18000-RG, transcript variant G (sw), mRNA 
0   NM_057723.3  CG18000-RH, transcript variant H (sw), mRNA 
0   NM_057726.3  CG18000-RA, transcript variant A (sw), mRNA 
0   NM_057730.4  CG18000-RE, transcript variant E (sw), mRNA 
0   NM_057729.3  CG18000-RB, transcript variant B (sw), mRNA 
0   NM_057728.3  CG18000-RC, transcript variant C (sw), mRNA 
0   NM_206796.1  CG33499-RA (Sdic:CG33499), mRNA 
0   NM_057731.3  CG18000-RF, transcript variant F (sw), mRNA 
0   NM_057721.3  CG18000-RD, transcript variant D (sw), mRNA 
0   NM_057727.4  CG18000-RJ, transcript variant J (sw), mRNA 
0   NM_167693.2  CG32823-RB (Sdic:CG32823), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.