National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17848R-4 
 Symbol Or46a  Full Name Odorant receptor 46a 
 CG No CG33478  Old CG No CG17848 
 Synonyms Or46aB, Or46aA, Or46b, dor19, 46b, 46a, DOR20, DOR19, CG17849, AN9, 46F.1, AN8, DOR46F.2, DOR46F.1, Or46F.1, Or46F.2, Or19, CG17848, CG33478, Or46a 
 Accession No (Link to NCBI) NM_206071.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAGGTGTGGTACTTCCAAAT 
 Primer Seq. 3'
aatctagaggtaccGGAAAAGGTACTGCGACCAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAGGTGTGG TACTTCCAAA TCCTTGGTGT TTGGCAGCTC CCCACTTGGG CCGCAGACCA 
0061 CCAGCGTCGT TTTCAGTCCA TGAGGTTTGG CTTCATCCTG GTCATCCTGT TCATCATGCT 
0121 GCTGCTTTTC TCCTTCGAAC TGTTGAACAA CATTTCCCAA GTTAGGGAGA TCCTAAAGGT 
0181 ATTCTTCATG TTCGCCACGG AAATATCCTG CATGGCCAAA TTATTGCATT TGAAGTTGAA 
0241 GAGCCGCAAA CTCGCTGGCT TGGTTGATGC GATGTTGTCC CCAGAGTTCG GCGTTAAAAG 
0301 TGAACAGGAA ATGCAGATGC TGGAATTGGA TAGAGTGGCG GTTGTCCGCA TGAGGAACTT 
0361 CTACGGCATC ATGTCCCTGG GCGCGGCTTC CCTGATCCTT ATAGTTCCCT GTTTCGACAA 
0421 CTTTGGCGAG CTACCACTGG CCATGTTGGA GGTATGCAGC ATCGAGGGAT GGATCTGCTA 
0481 TTGGTCGCAG TACCTTTTCC  
 in silico PCR Fragment
0001 CCAGGTGTGG TACTTCCAAA TCCTTGGTGT TTGGCAGCTC CCCACTTGGG CCGCAGACCA 
0061 CCAGCGTCGT TTTCAGTCCA TGAGGTTTGG CTTCATCCTG GTCATCCTGT TCATCATGCT 
0121 GCTGCTTTTC TCCTTCGAAA TGTTGAACAA CATTTCCCAA GTTAGGGAGA TCCTAAAGGT 
0181 ATTCTTCATG TTCGCCACGG AAATATCCTG CATGGCCAAA TTATTGCATT TGAAGTTGAA 
0241 GAGCCGCAAA CTCGCTGGCT TGGTTGATGC GATGTTGTCC CCAGAGTTCG GCGTTAAAAG 
0301 TGAACAGGAA ATGCAGATGC TGGAATTGGA TAGAGTGGCG GTTGTCCGCA TGAGGAACTC 
0361 CTACGGCATC ATGTCCCTGG GCGCGGCTTC CCTGATCCTT ATAGTTCCCT GTTTCGACAA 
0421 CTTTGGCGAG CTACCACTGG CCATGTTGGA GGTATGCAGC ATCGAGGGAT GGATCTGCTA 
0481 TTGGTCGCAG TACCTTTTCC  
 Assemble Data

17848R-4.IR_full       1   CCAGGTGTGGTACTTCCAAATCCTTGGTGTTTGGCAGCTCCCCACTTGGGCCGCAGACCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17848R-4.in silico     1   CCAGGTGTGGTACTTCCAAATCCTTGGTGTTTGGCAGCTCCCCACTTGGGCCGCAGACCA 60


17848R-4.IR_full       61  CCAGCGTCGTTTTCAGTCCATGAGGTTTGGCTTCATCCTGGTCATCCTGTTCATCATGCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17848R-4.in silico     61  CCAGCGTCGTTTTCAGTCCATGAGGTTTGGCTTCATCCTGGTCATCCTGTTCATCATGCT 120


17848R-4.IR_full       121 GCTGCTTTTCTCCTTCGAACTGTTGAACAACATTTCCCAAGTTAGGGAGATCCTAAAGGT 180
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
17848R-4.in silico     121 GCTGCTTTTCTCCTTCGAAATGTTGAACAACATTTCCCAAGTTAGGGAGATCCTAAAGGT 180


17848R-4.IR_full       181 ATTCTTCATGTTCGCCACGGAAATATCCTGCATGGCCAAATTATTGCATTTGAAGTTGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17848R-4.in silico     181 ATTCTTCATGTTCGCCACGGAAATATCCTGCATGGCCAAATTATTGCATTTGAAGTTGAA 240


17848R-4.IR_full       241 GAGCCGCAAACTCGCTGGCTTGGTTGATGCGATGTTGTCCCCAGAGTTCGGCGTTAAAAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17848R-4.in silico     241 GAGCCGCAAACTCGCTGGCTTGGTTGATGCGATGTTGTCCCCAGAGTTCGGCGTTAAAAG 300


17848R-4.IR_full       301 TGAACAGGAAATGCAGATGCTGGAATTGGATAGAGTGGCGGTTGTCCGCATGAGGAACTT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
17848R-4.in silico     301 TGAACAGGAAATGCAGATGCTGGAATTGGATAGAGTGGCGGTTGTCCGCATGAGGAACTC 360


17848R-4.IR_full       361 CTACGGCATCATGTCCCTGGGCGCGGCTTCCCTGATCCTTATAGTTCCCTGTTTCGACAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17848R-4.in silico     361 CTACGGCATCATGTCCCTGGGCGCGGCTTCCCTGATCCTTATAGTTCCCTGTTTCGACAA 420


17848R-4.IR_full       421 CTTTGGCGAGCTACCACTGGCCATGTTGGAGGTATGCAGCATCGAGGGATGGATCTGCTA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17848R-4.in silico     421 CTTTGGCGAGCTACCACTGGCCATGTTGGAGGTATGCAGCATCGAGGGATGGATCTGCTA 480


17848R-4.IR_full       481 TTGGTCGCAGTACCTTTTCC 500
                           ||||||||||||||||||||
17848R-4.in silico     481 TTGGTCGCAGTACCTTTTCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206071.1  CG33478-RB, transcript variant B (Or46a), mRNA 
0.62   NM_001031917.1  CG1414-RB, transcript variant B (bbx), mRNA 
0.62   NM_001031916.1  CG1414-RC, transcript variant C (bbx), mRNA 
0.62   NM_001031918.1  CG1410-RA, transcript variant A (waw), mRNA 
0.41   NM_142188.2  CG6276-RA (CG6276), mRNA 
0   10  NM_165331.2  CG31687-RA (CG31687), mRNA 
0   10  NM_136191.2  CG31688-RA (CG31688), mRNA 
0   13  NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_168171.1  CG32397-RA (CG32397), mRNA 
0   NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0   NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
0   NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
0   NM_206395.2  CG6292-RA, transcript variant A (CycT), mRNA 
0   NM_079403.3  CG6292-RB, transcript variant B (CycT), mRNA 
0   NM_134551.4  CG32506-RA (CG32506), mRNA 
0   NM_131961.1  CG2861-RA, transcript variant A (CG2861), mRNA 
0   NM_167021.1  CG2861-RB, transcript variant B (CG2861), mRNA 
0   NM_001014757.2  CG33517-RD, transcript variant D (D2R), mRNA 
0   NM_001014758.2  CG33517-RC, transcript variant C (D2R), mRNA 
0   NM_001014760.2  CG33517-RA, transcript variant A (D2R), mRNA 
0   NM_001031909.1  CG33517-RE, transcript variant E (D2R), mRNA 
0   NM_168626.1  CG7439-RC, transcript variant C (AGO2), mRNA 
0   NM_140518.1  CG7439-RB, transcript variant B (AGO2), mRNA 
0   NM_130634.2  CG3091-RA, transcript variant A (CG3091), mRNA 
0   NM_001038736.1  CG3091-RB, transcript variant B (CG3091), mRNA 
0   NM_143259.1  CG5521-RA (CG5521), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_078773.2  CG31628-RA, transcript variant A (ade3), mRNA 
0   NM_166207.1  CG6829-RB, transcript variant B (Ark), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.