National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17838R-3 
 Symbol CG17838  Full Name CG17838 
 CG No CG17838  Old CG No CG17838 
 Synonyms AI945337, cg17838, l(3)03806, anon-WO0118547.613, CG17838 
 Accession No (Link to NCBI) NM_169927.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGTTTTCTGCGGCAAGATA 
 Primer Seq. 3'
aatctagaggtaccTCAAGAAAGCAAAAGCCGCGA 
 Predicted Fragment Size
389 
 IR fragment full Seq
0001 GAGGTTTTCT GCGGCAAGAT ACCCAAGGAC ATGTACGAGG ACGAACTGAT TCCGCTATTC 
0061 GAGAACTGCG GCATAATCTG GGACCTACGA CTCATGATGG ACCCGATGAC GGGCACAAAT 
0121 CGTGGTTATG CATTTGTCAC ATTCACAAAT CGCGAAGCGG CCGTCAATGC AGTGCGACAG 
0181 CTCGATAATC ACGAAATAAA ACCCGGCAAG TGTCTAAAAA TAAATATAAG CGTACCGAAT 
0241 CTGCGCCTTT TCGTAGGCAA TATTCCCAAG TCAAAGGGCA AAGATGAAAT TTTAGAGGAA 
0301 TTTGGTAAAC TTACAGCTGG CCTATACGAG GTAATCATAT ACAGTTCGCC AGATGATAAG 
0361 AAAAAGAATC GCGGCTTTTG CTTTCTTGA 
 in silico PCR Fragment
0001 GAGGTTTTCT GCGGCAAGAT ACCCAAGGAC ATGTACGAGG ACGAACTGAT TCCGCTATTC 
0061 GAGAACTGCG GCATAATCTG GGACCTACGA CTCATGATGG ACCCGATGAC GGGCACAAAT 
0121 CGTGGTTATG CATTTGTCAC ATTCACAAAT CGCGAAGCGG CCGTCAATGC AGTGCGACAG 
0181 CTCGATAATC ACGAAATAAA ACCCGGCAAG TGTCTAAAAA TAAATATAAG CGTACCGAAT 
0241 CTGCGCCTTT TCGTAGGCAA TATTCCCAAG TCAAAGGGCA AAGATGAAAT TTTAGAGGAA 
0301 TTTGGTAAAC TTACAGCTGG CCTATACGAG GTAATCATAT ACAGTTCGCC AGATGATAAG 
0361 AAAAAGAATC GCGGCTTTTG CTTTCTTGA 
 Assemble Data

17838R-3.IR_full       1   GAGGTTTTCTGCGGCAAGATACCCAAGGACATGTACGAGGACGAACTGATTCCGCTATTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17838R-3.in silico     1   GAGGTTTTCTGCGGCAAGATACCCAAGGACATGTACGAGGACGAACTGATTCCGCTATTC 60


17838R-3.IR_full       61  GAGAACTGCGGCATAATCTGGGACCTACGACTCATGATGGACCCGATGACGGGCACAAAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17838R-3.in silico     61  GAGAACTGCGGCATAATCTGGGACCTACGACTCATGATGGACCCGATGACGGGCACAAAT 120


17838R-3.IR_full       121 CGTGGTTATGCATTTGTCACATTCACAAATCGCGAAGCGGCCGTCAATGCAGTGCGACAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17838R-3.in silico     121 CGTGGTTATGCATTTGTCACATTCACAAATCGCGAAGCGGCCGTCAATGCAGTGCGACAG 180


17838R-3.IR_full       181 CTCGATAATCACGAAATAAAACCCGGCAAGTGTCTAAAAATAAATATAAGCGTACCGAAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17838R-3.in silico     181 CTCGATAATCACGAAATAAAACCCGGCAAGTGTCTAAAAATAAATATAAGCGTACCGAAT 240


17838R-3.IR_full       241 CTGCGCCTTTTCGTAGGCAATATTCCCAAGTCAAAGGGCAAAGATGAAATTTTAGAGGAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17838R-3.in silico     241 CTGCGCCTTTTCGTAGGCAATATTCCCAAGTCAAAGGGCAAAGATGAAATTTTAGAGGAA 300


17838R-3.IR_full       301 TTTGGTAAACTTACAGCTGGCCTATACGAGGTAATCATATACAGTTCGCCAGATGATAAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17838R-3.in silico     301 TTTGGTAAACTTACAGCTGGCCTATACGAGGTAATCATATACAGTTCGCCAGATGATAAG 360


17838R-3.IR_full       361 AAAAAGAATCGCGGCTTTTGCTTTCTTGA 389
                           |||||||||||||||||||||||||||||
17838R-3.in silico     361 AAAAAGAATCGCGGCTTTTGCTTTCTTGA 389

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   371  NM_169926.1  CG17838-RD, transcript variant D (CG17838), mRNA 
100   371  NM_169927.1  CG17838-RA, transcript variant A (CG17838), mRNA 
100   371  NM_169928.1  CG17838-RC, transcript variant C (CG17838), mRNA 
100   371  NM_169929.1  CG17838-RF, transcript variant F (CG17838), mRNA 
100   371  NM_169925.1  CG17838-RE, transcript variant E (CG17838), mRNA 
59.02   219  NM_142656.2  CG17838-RB, transcript variant B (CG17838), mRNA 
0   NM_138189.2  CG6905-RA (CG6905), mRNA 
0   NM_132295.1  CG6999-RA (CG6999), mRNA 
0   NM_167175.1  CG32706-RA (CG32706), mRNA 
0   NM_139551.1  CG14961-RA (CG14961), mRNA 
0   NM_143526.1  CG9737-RA (CG9737), mRNA 
0   NM_141009.2  CG32432-RA (CG32432), mRNA 
0   NM_137047.2  CG6197-RA (CG6197), mRNA 
0   NM_140458.1  CG17177-RA (CG17177), mRNA 
0   NM_001014493.1  CG33510-RA (CG33510), mRNA 
0   NM_134837.2  CG9887-RA (VGlut), mRNA 
0   NM_080049.2  CG11614-RA (nkd), mRNA 
0   NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_058021.3  CG2331-RA, transcript variant A (TER94), mRNA 
0   NM_165726.1  CG2331-RB, transcript variant B (TER94), mRNA 
0   NM_135406.2  CG9463-RA (CG9463), mRNA 
0   NM_141779.2  CG6621-RA (CG6621), mRNA 
0   NM_167038.1  CG3239-RB, transcript variant B (CG3239), mRNA 
0   NM_131998.2  CG3239-RA, transcript variant A (CG3239), mRNA 
0   NM_206597.1  CG4122-RF, transcript variant F (svr), mRNA 
0   NM_080293.3  CG4122-RB, transcript variant B (svr), mRNA 
0   NM_206596.1  CG4122-RG, transcript variant G (svr), mRNA 
0   NM_169848.1  CG5629-RA, transcript variant A (CG5629), mRNA 
0   NM_142527.2  CG5629-RB, transcript variant B (CG5629), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.