National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1782R-2 
 Symbol Uba1  Full Name Ubiquitin activating enzyme 1 
 CG No CG1782  Old CG No CG1782 
 Synonyms CG1782, uba-1, DmUba1, Uba 1, UBA-1, E1, 2/31, l(2)03405, l(2)05642, l(2)s3484, Uba1 
 Accession No (Link to NCBI) NM_057962.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wu JT, Lin WH, Chen WY, Huang YC, Tang CY, Ho MS, Pi H, Chien CT.
CSN-mediated deneddylation differentially modulates Ci(155) proteolysis to promote Hedgehog signalling responses.
Nat Commun (2011) 2 182 [ PubMed ID = 21304511 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCACGATGCGATGCGTCGGA 
 Primer Seq. 3'
aatctagaggtaccCTGTGCGTCGTGCGTGATACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTCACGATGC GATGCGTCGG ATGGCCAATT CGGATATCCT TCTGTCGGGA CTTGGAGGAC 
0061 TCGGCCTGGA GATAGCCAAG AATGTGATTC TGGGCGGCGT GAAATCGATC ACCTTGCATG 
0121 ACACAGCAAC TTGTGGGCTC CATGACTTGT CGTCGCAATT CTATCTCACG GAAGCCGATA 
0181 TCGGCAAGAA TCGTGCGGAG GCCTCTTGCG CCCAGTTGGC CGAGTTAAAC AACTATGTGC 
0241 GCACCGTTTC GCACACGGGG CCGCTTACCG AGGAGTTCCT GCGCAAGTTT CGCGTTGTGG 
0301 TACTGACCAA CTCCGACGGG GAGGAGCAGC AGAGGATCGC CAAGTTTGCC CATGAAAATG 
0361 GCATTGCTCT GATCATCGCC GAGACGCGCG GACTGTTCGC CAAGGTGTTC TGTGACTTTG 
0421 GCGAGAGCTT TACCATTTAC GATCAGGATG GCACACAGCC GATCTCCACC ATGATAGCTA 
0481 GTATCACGCA CGACGCACAG  
 in silico PCR Fragment
0001 GTCACGATGC GATGCGTCGG ATGGCCAATT CGGATATCCT TCTGTCGGGA CTTGGAGGAC 
0061 TCGGCCTGGA GATAGCCAAG AATGTGATTC TGGGCGGCGT GAAATCGATC ACCTTGCATG 
0121 ACACAGCAAC TTGTGGGCTC CATGACTTGT CGTCGCAATT CTATCTCACG GAAGCCGATA 
0181 TCGGCAAGAA TCGTGCGGAG GCCTCTTGCG CCCAGTTGGC CGAGTTAAAC AACTATGTGC 
0241 GCACCGTTTC GCACACGGGG CCGCTTACCG AGGAGTTCCT GCGCAAGTTT CGCGTTGTGG 
0301 TACTGACCAA CTCCGACGGG GAGGAGCAGC AGAGGATCGC CAAGTTTGCC CATGAAAATG 
0361 GCATTGCTCT GATCATCGCC GAGACGCGCG GACTGTTCGC CAAGGTGTTC TGTGACTTTG 
0421 GCGAGAGCTT TACCATTTAC GATCAGGATG GCACACAGCC GATCTCCACC ATGATAGCTA 
0481 GTATCACGCA CGACGCACAG  
 Assemble Data

1782R-2.IR_full       1   GTCACGATGCGATGCGTCGGATGGCCAATTCGGATATCCTTCTGTCGGGACTTGGAGGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1782R-2.in silico     1   GTCACGATGCGATGCGTCGGATGGCCAATTCGGATATCCTTCTGTCGGGACTTGGAGGAC 60


1782R-2.IR_full       61  TCGGCCTGGAGATAGCCAAGAATGTGATTCTGGGCGGCGTGAAATCGATCACCTTGCATG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1782R-2.in silico     61  TCGGCCTGGAGATAGCCAAGAATGTGATTCTGGGCGGCGTGAAATCGATCACCTTGCATG 120


1782R-2.IR_full       121 ACACAGCAACTTGTGGGCTCCATGACTTGTCGTCGCAATTCTATCTCACGGAAGCCGATA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1782R-2.in silico     121 ACACAGCAACTTGTGGGCTCCATGACTTGTCGTCGCAATTCTATCTCACGGAAGCCGATA 180


1782R-2.IR_full       181 TCGGCAAGAATCGTGCGGAGGCCTCTTGCGCCCAGTTGGCCGAGTTAAACAACTATGTGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1782R-2.in silico     181 TCGGCAAGAATCGTGCGGAGGCCTCTTGCGCCCAGTTGGCCGAGTTAAACAACTATGTGC 240


1782R-2.IR_full       241 GCACCGTTTCGCACACGGGGCCGCTTACCGAGGAGTTCCTGCGCAAGTTTCGCGTTGTGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1782R-2.in silico     241 GCACCGTTTCGCACACGGGGCCGCTTACCGAGGAGTTCCTGCGCAAGTTTCGCGTTGTGG 300


1782R-2.IR_full       301 TACTGACCAACTCCGACGGGGAGGAGCAGCAGAGGATCGCCAAGTTTGCCCATGAAAATG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1782R-2.in silico     301 TACTGACCAACTCCGACGGGGAGGAGCAGCAGAGGATCGCCAAGTTTGCCCATGAAAATG 360


1782R-2.IR_full       361 GCATTGCTCTGATCATCGCCGAGACGCGCGGACTGTTCGCCAAGGTGTTCTGTGACTTTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1782R-2.in silico     361 GCATTGCTCTGATCATCGCCGAGACGCGCGGACTGTTCGCCAAGGTGTTCTGTGACTTTG 420


1782R-2.IR_full       421 GCGAGAGCTTTACCATTTACGATCAGGATGGCACACAGCCGATCTCCACCATGATAGCTA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1782R-2.in silico     421 GCGAGAGCTTTACCATTTACGATCAGGATGGCACACAGCCGATCTCCACCATGATAGCTA 480


1782R-2.IR_full       481 GTATCACGCACGACGCACAG 500
                          ||||||||||||||||||||
1782R-2.in silico     481 GTATCACGCACGACGCACAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057962.4  CG1782-RA (Uba1), mRNA 
0.2   NM_133020.2  CG6506-RA (CG6506), mRNA 
0   NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_057252.3  CG3758-RA (esg), mRNA 
0   NM_137276.2  CG6251-RA (Nup62), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
0   NM_140058.2  CG3529-RB (CG3529), mRNA 
0   NM_143012.1  CG5789-RA (CG5789), mRNA 
0   NM_165838.2  CG17835-RC, transcript variant C (inv), mRNA 
0   NM_078975.3  CG17835-RB, transcript variant B (inv), mRNA 
0   NM_165837.2  CG17835-RA, transcript variant A (inv), mRNA 
0   NM_131987.2  CG4202-RA (Sas10), mRNA 
0   NM_165839.2  CG17835-RD, transcript variant D (inv), mRNA 
0   NM_078811.2  CG5387-RA (Cdk5alpha), mRNA 
0   NM_132380.1  CG15311-RA (CG15311), mRNA 
0   NM_142755.1  CG5732-RA (CG5732), mRNA 
0   NM_079429.1  CG3801-RA (Acp76A), mRNA 
0   NM_134943.1  CG3213-RA (CG3213), mRNA 
0   NM_140564.1  CG17029-RA (CG17029), mRNA 
0   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_137533.3  CG15097-RA, transcript variant A (CG15097), mRNA 
0   NM_176232.1  CG15097-RB, transcript variant B (CG15097), mRNA 
0   NM_166232.1  CG30104-RB, transcript variant B (CG30104), mRNA 
0   NM_137374.2  CG30104-RA, transcript variant A (CG30104), mRNA 
0   NM_137016.3  CG17041-RA, transcript variant A (CG17041), mRNA 
0   NM_165977.1  CG17041-RB, transcript variant B (CG17041), mRNA 
0   NM_165978.1  CG17041-RC, transcript variant C (CG17041), mRNA 
0   NM_165951.1  CG17579-RB, transcript variant B (sca), mRNA 
0   NM_057362.2  CG17579-RA, transcript variant A (sca), mRNA 
0   NM_168932.1  CG32446-RA (CG32446), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.