National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1782R-1 
 Symbol Uba1  Full Name Ubiquitin activating enzyme 1 
 CG No CG1782  Old CG No CG1782 
 Synonyms CG1782, uba-1, DmUba1, Uba 1, UBA-1, E1, 2/31, l(2)03405, l(2)05642, l(2)s3484, Uba1 
 Accession No (Link to NCBI) NM_057962.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCACGATGCGATGCGTCGGA 
 Primer Seq. 3'
aatctagaggtaccCTGTGCGTCGTGCGTGATACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTCACGATGC GATGCGTCGG ATGGCCAATT CGGATATCCT TCTGTCGGGA CTTGGAGGAC 
0061 TCGGCCTGGA GATAGCCAAG AATGTGATTC TGGGCGGCGT GAAATCGATC ACCTTGCATG 
0121 ACACAGCAAC TTGTGGGCTC CATGACTTGT CGTCGCAATT CTATCTCACG GAAGCCGATA 
0181 TCGGCAAGAA TCGTGCGGAG GCCTCTTGCG CCCAGTTGGC CGAGTTAAAC AACTATGTGC 
0241 GCACCGTTTC GCACACGGGG CCGCTTACCG AGGAGTTCCT GCGCAAGTTT CGCGTTGTGG 
0301 TACTGACCAA CTCCGACGGG GAGGAGCAGC AGAGGATCGC CAAGTTTGCC CATGAAAATG 
0361 GCATTGCTCT GATCATCGCC GAGACGCGCG GACTGTTCGC CAAGGTGTTC TGTGACTTTG 
0421 GCGAGAGCTT TACCATTTAC GATCAGGATG GCACACAGCC GATCTCCACC ATGATAGCTA 
0481 GTATCACGCA CGACGCACAG  
 in silico PCR Fragment
0001 GTCACGATGC GATGCGTCGG ATGGCCAATT CGGATATCCT TCTGTCGGGA CTTGGAGGAC 
0061 TCGGCCTGGA GATAGCCAAG AATGTGATTC TGGGCGGCGT GAAATCGATC ACCTTGCATG 
0121 ACACAGCAAC TTGTGGGCTC CATGACTTGT CGTCGCAATT CTATCTCACG GAAGCCGATA 
0181 TCGGCAAGAA TCGTGCGGAG GCCTCTTGCG CCCAGTTGGC CGAGTTAAAC AACTATGTGC 
0241 GCACCGTTTC GCACACGGGG CCGCTTACCG AGGAGTTCCT GCGCAAGTTT CGCGTTGTGG 
0301 TACTGACCAA CTCCGACGGG GAGGAGCAGC AGAGGATCGC CAAGTTTGCC CATGAAAATG 
0361 GCATTGCTCT GATCATCGCC GAGACGCGCG GACTGTTCGC CAAGGTGTTC TGTGACTTTG 
0421 GCGAGAGCTT TACCATTTAC GATCAGGATG GCACACAGCC GATCTCCACC ATGATAGCTA 
0481 GTATCACGCA CGACGCACAG  
 Assemble Data

1055R-3.IR_full       1   ATGCAGTCCATCGAGGATAAGATCCGGGAGCAGGGAGAGATGTTGCGGGTGGAACGCGAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1055R-3.in silico     1   ATGCAGTCCATCGAGGATAAGATCCGGGAGCAGGGAGAGATGTTGCGGGTGGAACGCGAG 60


1055R-3.IR_full       61  CTACTGCACTTCTCGCAAGAGGAACTGAAACGGCAACGTGAAAATCTTGTGCTTCGAGAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1055R-3.in silico     61  CTACTGCACTTCTCGCAAGAGGAACTGAAACGGCAACGTGAAAATCTTGTGCTTCGAGAA 120


1055R-3.IR_full       121 AATATTGCTCGACGAGAGTTGCAACACGGAGCCAAGATGCTGATGTCGAACAACCGGCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1055R-3.in silico     121 AATATTGCTCGACGAGAGTTGCAACACGGAGCCAAGATGCTGATGTCGAACAACCGGCGC 180


1055R-3.IR_full       181 TCACTGCAGGATCTGCACCACGGTCTAGGAATCGGAAACGGAATGCTCAGTGCCTTCCAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1055R-3.in silico     181 TCACTGCAGGATCTGCACCACGGTCTAGGAATCGGAAACGGAATGCTCAGTGCCTTCCAG 240


1055R-3.IR_full       241 CCACCGCAACACCACCAGGTTCAAATGCCACCACCGCATCCGCAACAGATTTACGCCAAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1055R-3.in silico     241 CCACCGCAACACCACCAGGTTCAAATGCCACCACCGCATCCGCAACAGATTTACGCCAAT 300


1055R-3.IR_full       301 GTGCCGCAGCAGCAGCAACAGATGGTTCTGCATGCATATCACCAGATGGACACGNGACTA 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
1055R-3.in silico     301 GTGCCGCAGCAGCAGCAACAGATGGTTCTGCATGCATATCACCAGATGGACACG-GACTA 360


1055R-3.IR_full       361 CCGCAAGTCCATGTCGGATCTAAACGAGTTCTCCAACTGCCTGATACTGCCGCCAACGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1055R-3.in silico     361 CCGCAAGTCCATGTCGGATCTAAACGAGTTCTCCAACTGCCTGATACTGCCGCCAACGCC 420


1055R-3.IR_full       421 GCCCACAAAGCCATTGAGGGCTATGCAATTGAACGCCAATGGCCATGGCCTGNGAGCCAG 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
1055R-3.in silico     421 GCCCACAAAGCCATTGAGGGCTATGCAATTGAACGCCAATGGCCATGGCCTG-GAGCCAG 480


1055R-3.IR_full       481 ATTACGCTGTTANNACGAGGCA 502
                          ||||||||||||  ||||||||
1055R-3.in silico     481 ATTACGCTGTTAGCACGAGGCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.